Description :
From Genome Similarity Track
Location :
Scaffold_35:54007- 55958
Transcript NameFunction/comments
Physo_134957pol polyprotein homolog - fungus (Fusarium oxysporum) retrotransposon skippy

Sequence
1951 bases(100 bases per row)
GGGTGACGACCGGTGTCGACGAAGAAGGGCGACAGCTTCGACGAGCTGGACACCAGTCATACTCAATCATGGGCAGGTGCTCATTCCAGTCGTTGCCATG
GTACGAAACAGAGCATCGCAACGAGTCCTCGAGAGTCCGATTCTGACGCTCAGTTTGGCCATCGGCCTGCGCTCGGTGGGCAGTCGTCATCGCTGTCTTG
ATCTTCATCAGCTGTACCAGTGCTTTCCAGAACTTCGACGTGAACTTCGGGTCCCGGTCGGAGATGATGGTCGATGGGATACCATAGTACCGGATGACGT
TGTTGAAGAACAGCTTGGCAATGTCTTCCGCAGTCGCCGTGGTGTGCGTCGGGATGTAGACTGGACGCTTTGACAACTTGTCCACCACGACCATGATCGC
ATCAAAGCCGTCGGACACAGGCAAATGCGTGATGAAGTCAGTCGAGACAACATCCCAACACGCAGCGGGCAACGGGATCGGCTGAAGCTTTTCTGCTGTT
CGTCCGGTGCTTGACTTATACCTCATGCATGACTCGCAACTCTGAACGTAGGCTTTGATGTCCAGATCCATGCTCGGCCAGAAGTACCACTGTGCCGCAG
CAAGCTGAGTGCGACGGATGCCTGGGTGCACCATGATCGCCACATCATGCGCATTGTGAATGACATCGAGCCGAAGTTTCCGGTTGTTTGGCACACAGAG
GCGGCGTAGGCTGTTGTTGCTCTTCAAATAGATCAACCCACGAATGATTTCGTACTCTTCCGACGGGCGACCGGACTTCCACAGCGGCTTGAAGACTGAA
TCTTTGCTGTATGCCTTCTGAAACGCCCGCTTCGTTTGGTTATCCAGTTGGAGTGAGCTTATCACCGTGCTGTCCTCCATCGATGCTGCGTTCAATCTCA
TACGCCACTGTGCCGTGCCTACACCATGTGCCCTTGCGGCTGGCTGTTCGACGGCAAGCATCACGGCTTGATCGCGAGTCGGTATGCTTTGGAGCTTCTC
CGTAGCCTTGGTACGACGCGATGCCGCGGCGCGAATGTTCGTGCATGTCGGCGATGTCAAACACGCCGTACACACTGCCAGCGGCTCGGGTTCGGTTTCA
CCAGCCTCCGGTTCCTCCCTCGGACTTGAAGAAGCATCAGGGGGGCGCAATAACGCGTCGGTAACGACATTCAAAGCGCCTGGACGATGATGCAGCGTGA
ACTGGAAGGACGCAAAAAAGTCCAGCCAGCGAGCCAGGCGACCAGACAGGCGGGGATGCTGTATAAACCACTTGCACGCCGAGTTGTCCGTGTACACTTC
AAACGAGACTCCATGGAGGTAATCGCGCCAACGGGTGAGCGCTTGTTTGATCGCAAAGAGTTCCTTCTCGTGAACAGGCCAGTTCAGCTCATGCGGACCA
AGCTTCTTGCTGAAAAATGCCACGGGGAGATCATTGCCGCCATGCAGCTGAAAGAGGACTCCACCAATGCACGCGTGACTAGCATCCGTTGTCACAATGA
ACGGCTTGTCGAAGTCTGGCAGACGTAGTACCGGTGCGTGCTGGAGCGCAAGCTTGATGGCATTGAAAGCCTGGCGCTGACCGTCATCCCATACCCGCGC
CACATCTTTCTTGACCAAAGAGCTCAGCGGAAGTACCAGTGTCGCAAACTGATGGATGAAGCGACGATAATATCCGGCGAGGCCCAAGAAGCGCTGTAGA
TCTTTGATGTTGCTAGGCTCTGTCCACTCGACGATGGCTCGAGTTTTGCGAGCGTCCACGTGCAAGCCATCAGCTGAGATGGTGTGGCCAAGGAAGTCGA
CCGAAGCTTGACCGAAGTCGCACTTGTCCGGACGAGGGTAAAGCTTGTGAGCCCGATGGATTTCACAGACTTGCCGTAAGTGCTCGACGTGATCGGCNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATAG