Description :
From Genome Similarity Track
Location :
scaffold_1009:5400- 7872
Transcript NameFunction/comments
Pl_101572hypothetical protein PHYSODRAFT_410384
Pl_101573hypothetical protein PHYSODRAFT_510353

Sequence
2472 bases(100 bases per row)
CTTTTGCTTTCCACAACGGGTTTTGGCAAACGTATGCACCTGCGTAGTCGTAAAGTGTTTAGTTTTGTCACGGAAGATGGACAACGCGTTTATCCCAACG
TGCAAGCGACTCTGCAGTGCATTTCCAATTGCAGATGAACGATGTGTTGAAGGAGCTTTTGTTTCAGAGCCTACTGGTGTGGATTGATCTCGCCTGAGAC
TCCACTTTTTTCTTGGAAAACTGACAAGTTTTTATTCTCATTCTGTGTGAACGCAAGTTGGAGCTGAATGTAAACAAATGTAAGTTTTTGCTCGTCGGAT
TAAGTGGTGTGGTGAATTGATATACGGTGAAGGTATCGAGCATGGCCCTGAGCGGCTTGCTGCGTTGCGGCAGATGCCACTGACACCTACTGCGACAGCG
CTGCAGCACTTCCTTTGTGGTCTCAACTGGCTGTGCAACTCAATGGTTGACTAAACCCGGACTACAGCATCACTACAACAGAAGTTGGAGCAAGTGATGC
GACTCCGGGGCCGTCGTAAATCGCAGCTCAGTGGAGCTATTTTAGTGTGAAATGACGATGAGAATATTGCTTACGGGCAAACACTGGAAATGTTGGAGAA
ATCGTGCAAGCTTGTATTTCCAGACAAAATTGCTACTGTGTGCATGTTTTCGTATGCCTCTCTTACTGGGCATGCCTTAGTGTTGACACAAGTGTGTAAC
TGATTGGATGATGTTGCAGTTGAGGAGAAACAGCATGAGTTACGCATAAGTCGAGGTGGGTTGTTCAAAGGTGCGCAACGGACCTGGTCCATCATCGAGA
AAGAAACATATCCTCTTGTCAAGGCGTGTACTCATGTTGATTAGGGAGAAAGGTTTCCATGTCTAATCTTATCCGGCATTTCGCTCCCGATCATGATGTG
AAGCAGAACGTAAAAGGCAAGCTCCAACGCTGGGCGTTGGAGCTTGTAGGCTGCTGCTGTGTGATTCGCCATATTGACGGCGAGAAGAAACTGTGGGCTG
ACATCATCTCCCGTTGGGGTCAACCAGCACCATCTACGCTGTCTGACCTCGTGGAAGCGAAGCGAGTGACGAATCGAACATCCCAGGCGTTGTCTGTGTT
GAGACCATTGCAAGATGACCGGTTTGCCCAGCCAAAACGTGACGAGATCAGTCGGGTACAGCTACCGTTTCGTGATGACGCTCCCTCAGAAGATGGGTTG
GTGAATAGTGCTTTCGAAGTTAAAGGGAAGTTGGAGCTGCCGGCAAAAGCAAAGGCTATATTACAGCGGATGTTTGTAGTTGCTTATTGTGGTCCACAGG
GACACAGAGGTGCGAATGTGATTGTGGAACTCCTGAGTCGACGTTTCTCGCTCGCGAACTTGCGCCAGGCTGCCACTCGTTTCACCAACGCTTGTATCCT
TTGCAAGCACGTTGAAGGAGGAGTTGTGATTTAGCGAGATTAGACAGTGGATCGGCCGGTGGAGATGCGAAATGATTGTTTACACTTAGACTATTTGTAC
CTTGGTGAAAGTTATGGGGATGCTGAGTATGTTTTTGTACTAAAGGATGAGCTAACTAACTTCTGTGAGTTAGTGGCTACCGATTCAGCGAACAGCCAAA
CTGCTGTTACTGCTATTCTCGACTGGAATAAGAGGTTCGGTGCATCTAAGGCATGGGTTTCTGACCAAGGGGCTCACTTTAAGAATCTCGTGATGGAGCT
ATTGGCTGAGCGCATTGGTGCTAGCCACTATTTCGTTCCAATGTACACGCCGTGGATTAATGGTACCGTTGGAAGAATAAACCGTGATATTCTACGAGTA
CTGCAAGCCATGTTACTAGAAAGTCGATTAGACACACACAACTGGACGCACCTACTGCTCGTTGTTCAAGTTAACTTGAACCACATACCTGTATTTTTGT
TGGGAGATTATGCCCCTGTGGAGCTGTTCACTGAGCTACCGACACTTTCCGCCCTTGACACAGTGGTAGCACCGACAGAGCGCATGCTGCGAGGCCTATC
GATGGAGAAGGCAAAGCTCCGTGAGGTCATCGCCATAGCCTGCACGGCCTGCACCTACGTGACCGCCGCGAGCAACAGCGCGTGGCCGCCATGGCGCGTT
TTAAGGGGACTATACGCAACTTTTCGGTGGGAGACTATGTTCTATGGTCACGAGTCGACCATCGTTTACAAGGCGGCAAGCTACTTATGCGTTGGGTCGA
TCCTTTCAAGGTGACCAAGGCCCTCCCACACTCGTTCCTCATCCATCATCTACTCACCGGAGCTGAGCATGAAGTGCATGACTCTCGTAAAATTTCTACA
GTGATGCAGATCTCGGCGAGACCGCCGAGATTCGTGAGCACGTATCGCTTCAAGGCATCGTCCTAGAAGTACATGGGGATTGTGAGCCACCGTGTGAACA
TGGACACGGGTGAGCTCCAGTTGCTAGTGGCTTGGCGTGGCCTCCAGGATATCGAGAATTCGTGGGAGCCCG