Description :
From Genome Similarity Track
Location :
Scaffold_3596:540- 3098
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_3596-snap-gene-0.1Esophageal cancer associated protein

Sequence
2558 bases(100 bases per row)
GATCGTCGCGCGGTTGTCCAATATGATCAAGTGCGTCATGAACACAGAATCTGCGGGCACGGATTGGAGAGCTAGCTAATGCGTGTGTTGTTGATGTTGT
TTGGTATAGAGGTGTGGGTGAGCCCATGGTGGCGTTGTACACGCGTCTGTACTTGGCGCTCGCGAGTACCGAGTTAGTGAATCCAAGTGAGAAGGCGGCT
GTGCTCAGCAGTCTCTACGACTACTTTTTCGCGTTCCAGCAGTACCAAGACCAAGGAAAACTCACACAATTCCTGTACGACCAAAACCTCACACACAACG
ACTATCTGGAACTCCATTCACCAGCCGTCGAGTGGCTTATGAAGTGCACTGCTCAGCACGCCACCAACGAGGTCTTCGAGGCGCTTCTGGAACAGTACCA
AGAATACTCGGGCAGTTCAATGGTGCTCAAGCATCTCTGCGAATCGTTTGGGGCCTCGAGTTATGCATCGGACCCCATGCGAATCTTTCATCTTATGCGC
GTGGCGTCGCCGTCTCAGTTCTCGAAGTGCCATCTCTACAGCGTGCTGGCGGTTCAACTGAGTACCACGCCATCAATTGGGGCGGGAAGCAAAGACGCCA
AGCTGCGATTTCTGAACGAAGCCTGGAGCTCGATCACTGCGCAAGAAGATATCGAGATGTACATGGAGTGCGCGGCAGCATATATGAAGCTCATCGTCTC
CCACTACGCGCACCGCGAAGCAACCATTTTGTTGAAGGACGTCATGCGGCACCTCAATTCCACAACTCCCGACGAGCTTACGCCCAAGCTCTACAACCTC
TTGGGGGCGTTCATCGAGAATGTTGTCTACGGTGCACAACAACACGCCGAGTTTTTCACACGCCTCATCCCATCGGGCGAGTTCCTCAGTTTGATGGGCA
TGTTTCGCCGAGAAGCAAGTGTGGGCGTCGCTAAAAAGGTGCTGCAGGCATTTGTGAATGCCCAGGGATCGCAGAAACACAACTTTGGCAACCTACGGCT
CCACGTCGTCGGCCCGGAGGCAGCAGTCGCACACACGTTATTCGTCATTTGCTGCCGTGTACATGATGCGCTAGATTCGCTGAGCACAGTCTCTGAACGT
AATGACGCTACCAAAGACATTGCGGCTTTCATCTCGCGACTCGGCTATGCCAGACATCCGTCAGCTGCGTCCAGCTCCACAGTGTTATCCATGAACATGC
CGACCACCGACGCACAGCTCCAAGAAGAGGAAGAGGCGCTGCTGATGTTCTACATCGATTGTCGCAGTGCGTTTTACAAGCTCGAGCCAATCAAGTCGGT
GCTGACCAAGTGTGTCACAGCGCTTGCATTACGTGTGCGCGAGCGCATGCTGTCGGCGGCATCTCGACACAATAGTGGTGGCCCACGCGTGACCGATCGC
CGTCGCGATTTTATCAAGTCGTGTCTCGCATATGCACATATTACGATCCCATCGATCGACCAGGCGTTCCCTCGACTGGAGCTGCTCGCCCTCTGTGCGA
AAGCAGCACTCATCAACAACTGCCTACCTCAGCTTGAAGCCTTCTTGAAGTCAGCGATCGTTCTTGTGGCCGATCTGGACTACGTCCATAGTGTCGGTTC
TATATTCGATGGTCACCTAGTGCACGAGGCAGTTTTTCCCGACATGTCTGACACTGAGGTGGATCCAGTGCTGCGCGTGATCAGAGAACTGGTGCAAATT
GTCACGTACGCACCATCCACTGTTGACGACGAGCCATTTTACTTTGTTGAGGCTCTACGGAAGGCGCTGCTGGAACGCATGAAGTGGGACGATGCCACGT
CCAGTACTTCGGGTCGTGTGCGGCTTCAGGCGAGTTCGTGCCGGATCCGTGTCATCACTGCAGTCGCTCAGCTGTACGCGACGTGGGGGCAATCTCGACT
GCCGTCTCGTGTCGAAGGAGTCGATTCCAACGATGTGCTGTATGGTGTCGACGATGCCTTTCAGCAACAAACGCAGATGGCATTCAGCGCGATCCTAGAC
CAAGTCGTGCGTGATATTGAAGCCCTGTCGTCAGCATTCACCACGACGCCCAGTTGGGAAGTGGCGTCGATGCAAACCGAGCTTCTCGTGGAACTCGTTT
ACGTCGTGTTCCCGTTCTTATCATTTGAGGAGGACCAAGCAACCGGCGACGCCATCGATGATATGCCGACCGCACCCACAGAATTGATGGAAGAGAATCG
TCGACAGTACAAGCAGGGTCGTAGTGGCGCGACGCTGCTTCGCAAGTGTTTGCTGTTTGCGATGGAAAAGCTTCGTGTCATGACAGACGAACCCGACCAG
CAGTATCAAGAGAAGAAAGGGCAGCGGGTCGAAGCCTTAAAAGTCAAGTTGCTCGACGTTGTAAAGTCCCTCCACGAGTACGTGCAGTATCAGCAAAAGA
AGCGAGCGCTGCTATACTCTGCCGCCGCCTGCCAAGCTTTGAACGCATTGGAAACGGTGACCAGCACCCTCACAGGGCCCGCCTAAGAGAGAGAATCTGT
GAACACGAGAAGAGGGAATTTGTATGGAATATTTCGGGTTGGTCACCTGCTCTGACTT