Description :
From Genome Similarity Track
Location :
scaffold_754:540- 2104
Transcript NameFunction/comments
Pl_102574hypothetical protein PHYSODRAFT_307748

Sequence
1564 bases(100 bases per row)
CGGCATTGAAGAATGTTATCCCGTGCATTCATGTATGATTTAGCGCAAAAGTGGTTATCACAGCTTGGTGAGAAACTCGTCCACTTCGTGATATCATTGA
AGGTTTTCTAAAAAAGCGTCCACTTCTGATTGCTGAAGCGATAATATGATGTCCTGTTCAGTGCTCGGGAAATCATTTTAACGCCGCTAACTGTTGAACA
AAATCGTTTTGGTAACACGGAAGTTATCACTTCGTAGTGATAAGATTGAATCCATATTCACGCACACCCGAGCCACTGTTCCTCCACATTGTCACAACTG
CAGCCGGCTGCGATTTCAGTTTTCCTCATATCGACGATCGTTTGTGAATACACACACTGAACAGTATTCATATCCTCGCTGAAGCAAATCCCAGCACCTT
CAAACTCTGATGAACAATCACGATAGAGGACACCGGCACAAACATCTTCTTGAAGCCATATACTTTTGACCATGTAGACACTAGGGCATTTTGCTTGGGT
TGGATCGCAGAAATTTGATACGTTCGCTGCAAACCGAGCTAAGCTTGAACGTGTCTTAGTCGTGGGGAGAAGAGAATTTTCGTCAGGGATGATGAGGCAG
GTTGATGGCAACGGGTTACCACTACTGCTATCGTTGCTGTCATCTACACAACAATTTAGGAAAGTCGTGTTGCAGACACCTTCGCTCAGAAATCCACTGC
AACAAACTGGTGTGTTCTGCACGAACATAATTTCCAATGTATCTGTATACAGCTCTACATTCGGAAGAGCGCGAACCTGCGAAAGTCCTTCCAGTGCTAT
TACTTGTATTGATTGGAGCTCTCCCATCAAGGGAAGTTCCGTGATCTCGTCCAAATAGCCAAAGTAGACGCTTTCCAGAGACTTTAGTCCAAACAACGAA
GGCAGACTTGGAAGGGAAGCATGGTAGGATAGGTGAATAGTGTGTAGACTTGCCATCGAGAAGAATAAATCACTTGGCAGCTGAATCAAATTGATATCAG
TGGAAACACCTTCAACGTGGCTAATACATTCACCAGAAACGACCTGGTCAGTCCATCAAATCCATTCCAGACAAGAACAACAGTAAACTCACAGATATTC
AAGTTGGGAAAACGAAGCAGATGTCCATGAAGGGAATACTTCTACTCCTGTGTGAATCAAAACGCTGCGGTACACGTTTGAGCATACTAAACTAGCGCCA
AAATGCACATATTTGAGGACGTACAGGTTTCGAAGATCCCGGCAAGTACGAAGATCGTCCGGAAGTGATCCGTTTATCTTGCGATTTACGAGTTGTACGG
TCTGGAGTTTACCGGCAGAAGCCAAATCTGCTAACCGTTGTGTGATGTCCGTCAGATTCTCCGAGTTTGCTGGTGCCATATCGCGGTCGACATACACAAG
ACACGCACATGCGTTGTTGGACGTCCACTGGTAAACATATTGAACGCACTCTGGATATGATAAACACGAGGCACGCGATACTTGTACAGCGACGGCAGTG
TACACAATGCAACCAATACCAAACACTAGAAAAGAAAAACCGATCGCCTTTCGAAGTCCGGACC