Description :
From Genome Similarity Track
Location :
Scaffold_709:54- 2665
Sequence
2611 bases(100 bases per row)
CGATCTCCAGCTCGTGAGCGTCACCTCGCGCGATATCGTGGGATGAGTCGACAGCGTCGGTCGCGTTCGCTCACCTCTTATTGGTCTCATACTCCTCAAC
GACGTCAGGAACCCATCCTGAGCCAACATACTTCGAGGCTCTCACGTGTCGTTTGTCGGTGAATAACCCAACCAATGGACCTTATAATTCGTCTCGGTTC
GACTCTTCGATGGCGCCGAGTCACTACTCGACGCAGGAGACGTGGGTTCTTCATGATCGACGATACAGTCCACAATCCAACGTCGCTCACCCGATGCATC
CACCAAGGGAGGGGAAGCATCACGACGGAATGTCTCATAGGTTGGGCGCCGATTCGCATAATCGAGCGCCTGTGCCGTCGAACGACGAGCTGCGTTTTCT
TCGTGCCGAAACTGAAGAGGCGGTGAACGGACTACTGGATGCCCGTGAGATGGTCGAGAGGACTCGACGGGAGCAGCAGGGGTTGGTGGAGCGTCTACGC
CAGCTTGAGACTGCTACGCTCGGTGGACCCCATCAGAATGATCCTGCACGGGCTCGAGCAGGACTTGTTCTCAGTCGTCGTCAGCGTCGTCGACAGGGGA
TGCCGGAATTTGAGCCGACACAGAAAGGCGGGGAAGGTTCGAAGAGAGATCCGCCGGCAGGTAAGCCTTCTGGCACCCGACATAGAAATTTGGGTGCAAA
CGCATAGTGGTAGGTATGTCTAGCGTGTAAGCATCTCCATGTGCCTTAACAACCCGAAAGGGGCCAATAGATCTTGGCGCTAAATTATAAGCCCAAGTTC
GTCGCAGATGTGTCTGGTAATCCTCTTGTCGATAACAAGACTCTGTCACCTTCTTTGAACGTCAACGTGTTCTTTCGACCTCTCTTGTGAACGTTCTCCT
TTCGTTTATCCACTGCTTTTTAAGGGCATCAGGTACAAAACGTTCTCCTTTTGTTTATTCACTGCTTCTTGAAGGGCATCACGTACAAAACGCATGATGC
CTTGTCGTAGTTATAGGAATTCGTTCACAGCAGCCGAACATACAGGTGAAGTGGAATCTTAAGGAGAAACATTAGATACTGGAGACGCGATAGGATACAT
CGCGACGGGACTCGATATGCCATTGTCTACGAACTTAACAGCATAAGCTGCATCGGCAGCAACCTGATCTTTAACGTAATCAATCATCAAATTTTTCGGC
GTAATACTATCGGCAGGTACTCCCCCACCAAGCTTACAAACCGGGTGTTCTGAAGCTGAAAGAGCAAGAAGCGCTGTAACGCAAGGGTGCCTCGCGTTGT
TCACAAAAATGGCGTCAACCCTGTTGACGCATGAGCTGCATTATTGATTGCAAATTCAGCGAGTGGGACCAATGAACTCCACGACGTAAACGATGTCGCA
TAACTGCGCATGACATCTGCAAGCACTCTGTTCATGCGCTCCGTTTTCCCATCCGTCTCTGGATGGGCTGCCGTAGCTATAAGCAATCGCGTGCCTAATA
GTTGAAACAACTCTGCCCAAAAAGTCGACGCGAAACTCTATTCACGGTCCAAAACAATGGATTCTGGCAAGCCGTGATGCCTGAATATGAGATCGAGAAA
GATCTTCGCGGTCGTCTCCACCGTAACGTGCGCGGAGACTGGATAAAATGAACCATTTTGCTAAATCGATCCACAAGAACCAGTACACCCGTGCATTTCT
GTTCAGCCGGTGGACGACCAAAGATGAAATCCATGCTGACCGAACGCCAGAATTCCGTGGCAATCGGAAGCGGTCGCAATGGAGATTGTGAATACGGCGC
AGGCTTTACACGCTGGCATGTTTCACAGGAGCGTACCCATTTCTGGATGTAATCGTTCATACGCGGCCAGAAAAAAACACGAGAAATGGCCGCGAGCGTC
GTTTTGCGACCCAGATGACCACCAGCTGGAGTGTCATGAAATTCATGCACCAATCGTGCTCGGAGTTCGTCATCAGTAGGGATGAAGACGCGCGATGGGT
CAAAGCCGTCCATTGTATACGTCAGCAGCGGACCATCAAGCGCGTAATGCTTAAGTTGTTGCGCGTTGGTTTCGTCAACTTCGTGAGTGACCCTCACTAG
GGTGTCGAAGGTAATTGGTAATTTCCGTGTAGAAAGAATCATTCGCATATGACTCAGCGATCTGTGTCCGAATTAACAGCACCGGTGTCNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNN