Description :
From Genome Similarity Track
Location :
Scaffold_922:54- 2462
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_18016Cullin-associated NEDD8-dissociated protein, putative

Sequence
2408 bases(100 bases per row)
GAGCACAAAGAGCGCTTCCAAGGCGGGGCCCTGAAGCAGGGCGCTCGCAGACAAGAGCAGCGCGTTGGGCAACACCTTGGTCACGACCACAGCGTCCGAG
GCTGCCGACGGCGACGTCGTAAGAATGGCCGAGACGAGCGTCAACGAGAGCTGGCTCAGTTGCAAGTCCGAGTCCGAAATCAAGGCCGACGCTTCTTGAA
TCGTGTCACAGAGGCTCGCAGCAGCCACCGACGCACCCTTGCTTTGAACCAAGGCGATGAGCGTATCCAACGCCGTCTGCTTGAGCGTGCGCGACTGCTG
GCGCAAAAGCTGCGAGAGGCAGACAATGGCGTCCGTCAATATGATCGAGAGGTCCAGCGGCAGCGGCGAGCGGGCGATCGTCGACAACGACTTCATGGCA
GCAATGCGAGTGATTTCGTTTTGCATGCGCTCGAGAATCATGGGCAGCACCGCGTTGAGGTCGTCACTGCTCAGATGATCGCCTATAAAACATCAGAAAT
ATGAAGCCAATCGTCAAGCATAGGGTTTACCGATCGTGGAGATGATAAGGCCCATGCTCGCGATAGCGCCATCCTTGATCTCTTGATCAATGTCGTACGC
CTTGAGGCGCGGGAGCACCGCGTTGAAGAGGGGCTGTACAAAGACCGCCATGTCTTGGGCCAACACCGCGCCAGTCGATGGACGGATAACGTGCACGATC
GTGCCAACGAGGGAGAGCGACTTGGCAACAATTTTGTACCACTCGTCGTTGGCATTGGCGACAGCCAAATGAACAATCGCCTTCATGTGCTTTGTGAAGA
GCGACGGCTCGTGGGTGGCCATGAGCTGGCGCAAAAAGATGAGTGCGTCGAGTTTGAGGCTCGAGTTGCGGTCCTCGAGGGCCTTCAAAATGTTCGGCAT
CAACGAGTCCATGAAGGGACCCAACTGGCCTTCTTCCACCTGGGCGAGCTCGCGCAGCATACCGAAGACGGCGCATCGCGTGGCCACCGAAATTTTGGGG
CCAAGCTGCTTGTTCGCGGCGCCCAAGATCGTACCAACACGCGTGTGGAGCTGGCCACCGCACGAGCGCTGGCGGACAAGCGCGGGATGGCCACCAGCTT
CGGGGTTGCCCGAGCTCACGGGCGCCAAATGCACAAGCGTGACGCGCAGGAGGTCCGAGAAGACCGAGAAAACGTCGATGCGGACGCTCTCTTCCCGCTC
CTTGAAACGCGAGACAAGCGGCTCGCTGCATTCGGCGTAGATGTCGTCGAGGAGCTCCGGGCGCGTGGTGATAACGGCCGACATGACGCGAAGCGCAGCA
CGGCGCACCTTCCAGCTCGCGTCATCGTCGTCGCTGTAATCATTGTCCTCGGGTTCGCTGTACTGCTCTTCATCGTCCATGTCCTCGTCCATGTCTTCGT
TCTCCGAGTCATACATGTAGTTCGGGTCGTACTTCGTGAACTTCATGGCCGTGGCAATGATGTTCTTGACGTGTACCGTGATCTCCGCGTGGCAGCGCAG
CAAGAACGACTCTAGGCCCTGGAAGCAATTCTCGCGAAGCTCGTTCGAGACGTCGTTTTGCATCGATTCGTCGTCTGGGGAGCCGCAAAACGTCAAGAAG
AGCGGGACAATCACGGGGAGATGACGGCCGAGACGATGTCCCACCGAGCGCGAGAGCGTACCGATCGTCTGGATCAGCGTGCGCTTGTCCGCTTCGTGGT
TGTTTTCGACGCTTTGGAGCAAGTGTTCGACCAAACGGTGCAGAAGAGCGTCGGCTGCGACAACACCCAGCGCACCAAGGCACGACGTCACGCGCTTGCG
CACAAAGGCTCGTTCATCGCTGAGCTCCTTTAGAAGAAGGTCCATGATGGCCACATGCTCGGACTGGAAGTCGGCGCCGAAGCGCTTCAAGAGTTCCGTC
AAGATGTCCAGCGTCTCCGACTTGATGGCCTGGTCTGCGTAATGCGAGATACCGTTGAGGAGGCGACCGCAGAGCGCCGTCGAGATCGACGCACCAGTCT
TCTGCGAAACGTCCGTCAAGATGGTCTTGAGGCCGATCGAGTAGATGTCACGGAGCTCGGGCTTGCCCGTAAAGATCAAGTCGCAAAGCTTCTCGCAGAT
GTCGCCAACTTGCTTCTCCTGGACCTTCGTCACAAGGATACCCAAACTACAAGGCGCATGAGTCCATGAGCACGCAATTTCAAGGCGCGTACCATTTCAC
AGCGATCGACTGCACGTCGTTGGACTTATCATCCAGCTGCTTGAGGACCGCAGCGCAGATCCTACGCTTCATGAGCATCGACAAGCTACGTGGAGAAAGG
TGCGTACTTGCGCTCAAGGTCCGGGCCAAGCTCAATGTCGTTCTGGAGCTCGTTGCAGAGGTCCGAGGTCGCCATGTAGCGCTCATCCTTGTCGAAGTCC
GTCGTCTA