Description :
From Genome Similarity Track
Location :
Scaffold_11:54- 2264
Transcript NameFunction/comments
Physo_108470reverse transcriptase
Physo_130333reverse transcriptase

Sequence
2210 bases(100 bases per row)
CGGGTACCGCAGCAAGATGTACCATCTTGCTGAAGCGGTCAACAAAGACCACAACGCCCGTGTTCCCCTGCCTGTCCGGGGAAATACCGAACACGAAGTC
CAAAGACATGGACTGCCAACACTCCGACGCAGTCGGCAGTGACTGCAAGGGAGCTTGCGCGAAAGGCGCAGGCTTCACACGTTGACAAACCTCGCAAGCA
CGGACGTACTTGCGCACCCATTTATACTGGTGGGTCCAGTAGAAGTCCCGCGTGAGAAGAAGGTATGTCTTCTCACGGCCCGGATGCCCCGCAGTTGGTG
CATCGTGATACTCATACATGATCCTGAGCCGCAGGTCATGGTCATTGGGCACGACAACGCGGTCCGCGTTGTCGTCGACTGCACGGTAGAGAATAACCCA
TCGTGCACCCGATAACGGTGTGCACGAGCACGAAGATGCTTCGGCAGCTTCTGACGAGATTTGTCAGAAGGTGCTGAGCCATAGGCCAGCAAGAGCTTCG
CGTCCGCGTCGTGCGCGTACGCGACCTTCACGTCGTCCAACAGTGACGACGTTGGGGTGCTCGATCACATGGCGTCAATGGCATTGACGTCGGCATCAGT
CGTGGCGTAGTCAGGTCGACGCCTGAGCGCGTCGGCCACCACATTGAGTCTTCCGGGTTTGTACTCAACCCGGAAGTTATACTCTGCGAAGAATGAGAGC
CATCTCGCCATCAGTAGCGAAATGTGCGGCGACTTCACAGCCATCCGCAGCGACGCGTGGTCCGTATAGACCACGAACGGTTTGCTTCCGAGTAGATACA
CTCGGAACTTCGCGAGTGCGTACTTCATGGCAAGGAGCTCCTTGTCATGTACCGGGTAGTTGCGCTCAGCTGGCTTCAGCTGACGCGATTGGTAGTAGAC
GACACGATCACGGCCCTCGTGATCGTGCTGCATCAACGCACATCCGATTGCGAAGTCGGATGCGTCACACACAACGTGGAATGGGCGATCTTGGTCGGCA
TCCGCCAAGATCGGCGCCTCAGTCAAGCCCCGCTTGACTGCATCGAAAGCCTGCTGACACTCAGCAGTCCAAATCCACTCGGCGTCCTTCTTCAGGAGCT
GTGACAGCGGGTGTATCATGCCCGCGTAGTCCTTTACGTACTTGCACAAGTACGTGGCCAAGCCAAGGAACTGCCGCAGTTCCTTGACGTTCGACGGCGT
CAGCCACTCATTGATCACTCTGACATCCTCAGGGTCAGGGCGGACACCGTTCTTCCCAACGAGACACCCGAGCACGGGTATCTCGCTCGCCCCGAAGATG
CACTTCTTCAGGTTCGCGTAGAGCTTCTGCTTGCGCTCATGCGCAAGCAGCTTCCGGAGATGCACCTTGTGCATCTCAACATCGCTCATTCCGTCTGCAG
CCCGGCTGTGGACGAACACATCGTCGAAGTAGCTCGGTGCGAAGTCGCGCACCGAGCGCAACAAGTGCGTCACGCACCTGTTGAAGGTCGCAGGGGCGTT
CTTCAGACCCTGCGGCATCTCTAGCCACTCCCAGAGCATGCTCACGCATGAGGATCTGATAGAACCCATCGCGCAGATCAAGAGCACTGTAGATAGTGCT
CCTGGTCATCGAATCGATGATAACATCTTTTCGAGGTATCGGTGTCTGCGCCGGTATCGCCGCATCGTTCAGCTTGTTGTACGCATGAATGATGCGCCAA
CCGCCCTGTGGCTTCTTGACACAGAACGTCGGAGCACTGTGCGGGGATTTCGATTCCCGCACTTGTCCAGCTTTGCGACGACTTTCGAAGAAGTCGTCGA
TCGCTTTGACCTGCTCTCGCGGCAGTGGCCACTGCCGCGTGACACAGTACTTCGTGCCCGGCACGAGATCAATCTCGTGCTGGATTCCCTTGTCCTGCGG
AAGCTCCGCAGGAATCTCTTCCGGAAGTACGTCCACGTACTCCCGTAAGATCTCGTAGTAGGGACTCATTTTCAACGAGTCCCAGCTCTGCTCTTCAAAG
CGCTCCTTCTTCGTCTTCGCACTGAGAGTGTCCTCGCTCTCAGTGGTGGTCTCCATGAAGAACTGCATCAGTTTCTTCATTCTCGCTCTTCGTTCTCTCG
GCGTCCGAGAGAATGCATATTTGCTCGATGCGTCCATCGTGCAAGTCACGCGCGAAGCGCTTCCAGCTCATGACTGGAAGCGAAGTCAACTCCGACGCTT
GCGTCGGAGG