Description :
From Genome Similarity Track
Location :
Scaffold_75:54- 2240
Transcript NameFunction/comments
g12264.t1hypothetical protein

Sequence
2186 bases(100 bases per row)
ACGCGGTTGACACGCTCTGTTTGTCCGTCGGTCTGCGGGTGATCCGCAGTCGACATGGACAACTGCGTCCCAAAAAGTGTAAACACTTCTTGCCAGAATC
GCGCTGTAAAGCGCGGATCCCGATCCGACACGATGTCGAGTGGCATACTATGGTGTCTAAACACCAGGTCAACAAACAGACATGCCGTCTGTTTGGCTGT
CACCTCGGCTGGTACTGCAGCAAGATGCACCATCTTGCTGAAGCGGTCAACAAAGACCACAATACCAGTCCTCGTTGTCTTGCGGAAGACCAAAAACAAA
GTCCATTGAAATGGACTGCCAGCACTCCGACGGAGTCGGTAGTGATTGAAGCGGAGCCTGCGATTTGGGCGCAGGCTTCACGCGCTGGCATACCTCGCAA
GCACGAACGTACTTGCGTACCCATTTGTACTGGTGACTCCAATAGAAGTCACGCGTGAGAAGCAAGTATGTCTTCTCACGGCCAGGATGTCCCGATGTCG
GGGCATCGTGGTACTCGTACGTGATCTTGAGCTTCAGCTCATGATCATCCGGCACGACAATGCGATCTGCGTTGTCGTCGACTGCGCTGTAAAGCAGCAG
ACCATTGTGTACACGATAACGGTGTACACGGGCACGAAGGTGTTTGGCCAGCTTCTGACGAGACCTGTCAGAAGGTGTGGAGAGGTACTCCAACAACTGC
TTCGCATCCGCATCATGTGCGTATGCGGCCTTCACTTCGTCCAGCAAGGACGACGAGGGTGTAGTCGTCCTGACGACGCCAACTGCCTTGGCGTCGGCCC
CGTGCACCGCATAATCTGGTCGACGCGAAAGCGCGTCGGCCACGACATTCAACCTTCCAGGTTTGTACTCAACCTGGAAGTTGTATTCAGCAAAGAATGA
CAGCCACCGTGCCATTCTTTGGGATATGTGCGGCGACTTGATCACCGTACGCAACGATGCGTGGTCGGTTTAGACCACGAATGGTCTACTCCCAAGTAGA
TACACTCGAAACTTTGCGAGTGCATACTTCATGGCAAGAAGTTCCTTGTCATGTACCGGGTAATTGCGCTCAGCTGGCTTCAGCTGACGCGATTGGTAGT
AAACCACGCGATCACGACCTTCGTGATCGATTTGCATCAGTGCGCATCCGATCGCGAAATCGGATGCATCGGGCGATCTTGGTCGGCCACCGCCAAGATC
GGCGCCTCAGTCAAGCCCTGCTTGACTGCTTCGAAGGCCTGCTGACAATCAGCAGTCCATTCCCATGCAGCCTCTTTCTTCAAGAGCTGCGACCGCGGGC
GAATCTTGCCCGCGTAGTTGCTCACGTACTTGCACAAGTACGTGGTGAGTCCAAGGAACTGCCGCAGTTCCTTTACGTTTGAAGGCGTAGGCCATTCCTT
GATCACTCTGACCTTTCCTGGGTCAGGGCGTACGCCGTTCTTCCCCACGAGACACCCAAGTACGGGTATCTCGGTCGCCCCGAAGATACACTTCTTCAGA
TTCGCGTAGAGCTTGTGCTTTCGCATGAGCTCAAGCAACTTGCGGAGATGCTCTGTATGCATCTCCACGTCCGATTTCCCATTCACAGCCCGGCTGTGAA
TGAACACGTCGTCAAAATAGCTCGGTGCGAAGTCGCGCACCGAGCGCAACAAGTGCGTGACGCACCTGTTGAACGTCGCTGGGGCGTTCTTCAGCCCCTG
TGGCATCACGAGCCACTCCCAGAGCATGCCGCTCGGAGTGCTTACCGCCGTGAGAGGAATATCACTCTCACGCATGAGGATCTGATAGAACCCGTCTCTC
AGATCCAGAGTACTGAAGATAGTACTCGAGGTCATCGAGTCGATGATCACATCTTTTCGAGGTATCGGCGTCTGCGCCGGTACCGTCGCATCGTTCAGCT
TGTTGTACGCATGAACGATGCGCCACCCGCCCTGTGGTTTCTTCACACAGAACGTAGGTGCGCTGTGCGGGGACTTCGATTCCCGCACTTGTCCTGCATT
GCGACGACTTTCAAAGAAGTCATCGATTGCCTTGACTTGCTCACGCGGCAGTGGCCACTGTCGCGTGACGCAGTACTTCGTTCCCGGCACGAGATCAATC
TCGTGCTGAACACCCTTGTCCTGCGGTAACTCAGGAATGTCGTCCGGGAGTACATCCTTGTACTCACGCAAGACCTTGTAAAAGGG