Description :
From Genome Similarity Track
Location :
Scaffold_3760:54- 2072
Sequence
2018 bases(100 bases per row)
AAGTCTCGATACTGGGACTGATCTCCGGAGCGGCCACTCCGGTCACACAATATTCGAGCCGGCACGAGATCGATCTCGTGGCGATTCCTCGTCAGCTGGC
AACTCAGCTGGGATCTATCCGGAAATACATCTTCATATTCGCGGGCGGTCTGGTAGACTGGATTGCGGATTCGCGTAGCGCGTCCCAGACTGCGCTGCGA
AGCGCTCCTCGCGGGCCGACTTCGGCTCAGCGCTCTTGGGCGCGAGGGAGGCGTCGCCGTCACTGACTGCATTCACTTCGAGCGACGCGATCGGCGTCGG
TGATCAGGCAAACTGTTCGATTCATCGTCCTGAGGCCGCGAAGGAGGTTCTTTCAGGAGAGACCCGGAAGAGGCGAGAGATCGACCCTGCCTCGCCAGGC
GGGTTTGCAAGCTCGAGTGTTCGTCGGCGGCCAGAGGTACCTTCCACATACTCAAGCACGCAGACCGACTCCGTCGGTGAGCTGTCACTTGGTACGGGCT
CTCGGCGAGGTTTCAGCCGACGCCGCTTCGACTTCCTCTTTCGCCGCCTCGAGTGCGAACTCGAGGATGATGAGTCGCTCTCGCTGGACGAGATGTCACC
CCCCTCTAGCGGGAGCCCCTGCTCGACCGCGGTAGTGTTCAGCGGGAGCGCCAACTGCTCGACCACCGGCTCAATTGACGGGAGCCCCTGCTCGACCGCC
ATCTCGTTCGTCTGCGGGAGCCCCTGCTCGACCGCCATCTCGTTCGTCTGCGGGAGCCCCTGCTCGACCGCCATCTCATTCGTCTGCGGGAGCCCCTGCT
CGACCGCCGTCTCGTACATCTGCGGGAGCCCCTGCTCGACCGCCAGTTGGTCTTCATCCCCGCGGCGCCGCGGGGACTCGTCAGTTAACAGCACTGCGCA
AGTCGTGCAGAGAGGGCCATCGCTCACTCTGTGCACAACGTGCGTCGTGGATGACCGGTCCACGACGGTGACGTGAGGCCAATCCTTCTGGGCGACCAGG
AGGTGCGTGAACACCTCACTCACATCATAATCACTGCGGCGCTTGACCGACCGGGCCAACCAGTCAATCTCTGGTTGATAGCGCGTCAGCCACGGCATAC
CCAGGATGCAGTCAAACGCGTAATTCATCTCAATGACGAAGAAGTCGTCGTTGCTTCGGAAACCCGTCGAAACGTGTACGGAAGGGTAATCTCCGCGCCG
CGCGACGCGGCGTGATTTCCCATCGGCCAACTTGACAGCGACCTCCCCTCTACCTTTGCGGACAGTGATGTCCGACGGGAGTACCGACAAGCACGACGCG
CGGACGAAGTTGTTGGTCGCTCCTGAAATCAAAGGAGCGCTCGCAGTGGTCGCCGGGCACCCGGCGACATGAAAACTGACAATGATCAATCTTGAATCGC
TCGGCGTGGTGGTGGCATGAAAGTGTGCATGCAGCACAGGAGGGCTAGGAGATTAGGTTGACACCGGGGGACCCGGACCTCCATTCCAGCCAGTAGGGCG
CCCCGCACCTACTGACCCTGACCGTTTTTTGGCTGGTCAGAACTCACGGGCTCGGCATCGACATGCGCAAGCACTGGAGCTGGCGCGCGGCACTCCGCCG
CGCGGTGACCGACCTTCCGACAGCGGAAGCAAGTGAGAGAACGATTGTTCAGAGCACCGCTCCGACGCGCTGCATAGCGCTGACGATTGCTCGTCGCATC
GATAGCGTCGATGTCCATGGGCTCGGGCGCAGAATCCCGAGCAGAAGCAGGTAGCGCGTGAGCGTATGACGCCGCAACCACGTAGTCCTCGCGTAGGGCG
AGGGCGAATGCCTCTTCGAGCGTAGAGGGGTCCGATCTTGTAAGGCACGTACGCACGTGCATGCCTTCGCGCATACCGAACACGAATACATGAACCTGAG
AGGCCATATCGATCGGCTTAGACACGATGCACGACGCGAGGTGTCGTGTCTTCTGGACGCATTCGCGCATAGTCATCCCTGCCTTGCCGGAGGGCGAAGA
AGTCTGCCCATATTCGGG