Description :
From Genome Similarity Track
Location :
Scaffold_1933:54- 2044
Sequence
1990 bases(100 bases per row)
AAACGGGATGCAACTTGAGCCCCTTCGACAACTTCAGCTCGTAGGAGTCATGTTGAACTTGCTTCACGACCGGGTAAGGACCAATAAACCTTGGCGCAAG
TTTCTTCGCCTGTGCAAACCCCTTGTGACGAATGTTCAAGTTCCGTCCATCCAAAAGTACCATATTCCCGGGTTTGAAGTCTTGAGCAAGCCTGTTCTTG
TCATAATACGACTTCATTCGAGTTTGCGCCTCACTCATCGCGTCTTGTGCTATTTTCAGAATTGCGTCTTGCTTGAGCAGGAAATCATGTGCTGACTTCT
GCAACTGCTCAACCTCTGGGTCCCCAGCCACCTCATCTGGCATATAGGGCACATAACCCAGATCAGCCTCAAACGGTGACATACCGATCGAGGAATGGAC
ACGTCTGTTGTACGCGAATTCGGCGAGATGTAGGTATTCATCCCAATCATTCTGGAATGGGTTCACGACACCTCGTAGATAGTCTTCAATAAACCGATTA
GTACGCTCGGTCTGACCATCCGTTTGCGGGCGGAAGGCGGACGACAAGTTATGAGTTGTCTCTAATGTCTTAATCACCTCCTGCCAGAACTTTGATGTGA
ATTTCGAGTCACGGTCTGAGACGATCGACTTCGGCACTCCATGGTCTTTCACATAATTGGCCATGAATAGCGCAGCAGTCTCTTCTGCTGTTACCGCCGT
GTTCGTGGCAATGAACTTAGCACGCTTCGCCAACCGGTCCACAATAACCATAATGGCGTCTTTTCCGGCTGCCGTCTTCGGTAGTGCAACCATGAAGTCC
ATCGTCACATCAATCCATCTGCCTCCTGGAATTTCCAACGGTTGAAGTAGTCTCGGCGGCTTCGTTTGGCGTGCCTTTTTTCGCTGACTAAGCTCGCACG
TGTTCACATAACGCTGAATGTACTTCGACATCTTGGGCCAGTAATATTTCTTCTGGACGCCTAAGTATGTCTTGAAGTATCCGGGGTGACCTGCCGTGAC
CACATCGTGGTTTTCACAAATAACACGGTTCTTCAGATCTTCATTGTCCGGAATTACCAGTCGAGCATTTTCATCATCTCTCGTTTGGTAATACAGCAGT
CCATTCTTCACAGAGTAGCGTGGTACCTCTTTACCACTAGCGATACTCTGCAACAGCTCCTGAACTCTTCGGTCTGTATAGTACAGTTGTTTGGCCGAGT
GCGTCACAGTTGCACTGGTCGTTTGGACGCTAGCTACAATTTCACGGTTTCGAGCCGCTTCAATGAGCTCTAACCTGAGCGGCTTTGTGCTCAAAGAGTG
GGTTTCGAGACACTGCATCCGACACTTGGTTACTGTCGCCTGGAATCCATTTGAACTGTGGTTGGAACTCGGCTAGTTCATTAAACTAGCGAGCCACACG
ACGGTTTGTTGTCTTCTGCGTCAATATAGTCTCAATACTCTTGTGGTCTGTCTCCACCGAAAATGGCCGATCGAGCAGGTAGACTCTCCACACCCGAAGC
GCATGCATAATAGCCAGCAATTCCTGTTCGCGCACTGGGTAGTTTAGCTCCGCTGGTTTCATTTTACGACCAGTGAATGCGATCGGATGCTCGAGCCCTC
CCTCGTTTTGAAACAAGACTCCCCCTATGGCAAAGTTCGAGGCGTCCATACGAATACCGAACGGTTTTTCGAAATCAGGAAGTTGCAACACGGGAGGGGT
GGAGAGACGGCGCTTGAGTCCATGAAAACATTCCAACTGGTGCTCAGACAAATGCAGCGTTTCCTTTGGGCGCAAACCCTTAGTACTTTCATGCAATGGT
CCTGCGAATTGCGCGAAGTCGGCGCAAAAGCGCGAGACATAGACCGTAGTACCCAAGAAGCTTTCCATTTGCTTCTTTGTCCGTGGAATCGGCCACTCGC
GAATCACACGCACTTTGTCAGGGTCCATTCGAACACGATTGCGGCCCACAAAATCACCAAGACAAGGGATCTCTTCGACACCAAACTGGC