Description :
From Genome Similarity Track
Location :
Scaffold_331:54- 1224
Transcript NameFunction/comments
Pytap_DAOMBR444fgenesh_masked-pag1_scaffold_331-abinit-gene-0.38Sodium/hydrogen exchanger

Sequence
1170 bases(100 bases per row)
CTCATCCAGCTCGTGCTCGTGCACGTGGCGCACCGCATCGACCGCGCCAGTGCGCCACCTCTCGTGTCCACGTCGTCCTGGGCCGTCTTCTTCGGGCTCG
GCTGTGGTGCGCTGCTGgCCACCATGTCAGAGACGCGCGTGCACAGTGCAGGACTGGACCCGCAAGTCCTCTTCTTCGGTCTGCTTCCGCCCATCATTCT
TGAGGCCGGCTTCAATACGCAGCGCAAGGGGTTCTTCTCCAACTTCTGGGCCATCTTGgCCCTCGCGATTCTCGGCACcGTCGTCGCCACGTTCGTCACG
GGTGGACTGCTTATATGGATGGGTGAACGAGGGTGGATCACGCAGTTTACAGATGCTGAAGCGTTCCTCTACGGCgcccTCATCTCCGCGATTGACCCCG
TGGCCACGCTGCTCGTGTTCAAGAAGAGCAAGGCCCCGTCCCTGTTGTTCAACCTTGTCTTTGGTGAGAGCGTCCTCAACGATGCGGTCGGTACGTCGAC
AACACTCGTGACTGTGGATCGTTTGGATTCTCACACTTTCTGTTGTTGTAGCCATCGTGATCTTTACACTATtCcAGAAGTTCGTGTCGAGTGGCAACTC
GGAGGTCACTGTACACACAGGCATTTCCATGGTCACGGATCTTACCATTATCGGTTTGGGCTCTGTGGCTCTGGCTGCTGTGGTCTGCTACAGCTCCGCT
TACTACTTGCGTCACTCGCACTCGTCGCTACGGGACCACGCCACGTATGAGATCTCCATCACTCTCCTCTCTGCGTATGCCAGCTACGTCGCGGCCGACT
TGTGTGAGCTGAGTGGCTTGCTCGCCGTCTTCTTCAGCGGCGTCTTCATCCGCCACTATCACATGTACAACATCGCACCCACAACTGCCGAAGCCTTCAA
GCATTTCCTCTCAACTGTCGCGTTCCTCGCAGAGAATTTCATCTACCTCTACCTCGGCATCAGTGTCATCGCTTACAATGGGTCTTTTGTATGGGACTGG
GGCTTCATCTTCGCGTCCTTCGCCGCGTGCCTCGTTGCGCGTGCTTTGAATACGTTTCCTCTCTGCTCGACAGCCAATCTATGGCGCTCTCCTGATCACC
GTATCCCGTTCAAGTATATGGTCGTCATCTGGTTCTCGGGGCTACGTGGAGCTATTGCGTTCGCTTTAGC