Description :
From Genome Similarity Track
Location :
Scaffold_98:53998- 58974
Transcript NameFunction/comments
Phypa_INRA-310PPTG_18987tubulin-specific chaperone D
Phypa_INRA-310PPTG_18988phospholipase D; Pi-TM-PLD
Phypa_INRA-310PPTG_18989inositol-3,4-bisphosphate 4-phosphatase

Sequence
4976 bases(100 bases per row)
TCATGTGAAATACATGCAGGAAATAGTCCCGCGTTACCTCAACTCTGGTATTATGGTAGCTTTCAAGGAGAACGGTGTTTCTGTCCAAGTTCCGAACCCG
AATGTGGCCGCAAGGCGAGGATTTCTACGTGCTGTGGGCGTTGCTGCGAAGGAGCTCATTCAACCGTGCATAAAGGAAGTCTTGGCTGCTGTCATTCAGT
CTACATCGCTTCAAGAGCGTCCAACTGAAGACGAAGATCCCGGAAGTCGAGTCGCGGCTGTGCAAGCGCTAGTTGACCTAAGTTCTAGACCCCCAGGTGA
GCTTGATCTTAAAGGTATGGAAGACTCTATAGTCCAGACACTCGTCCACTGTATCCATCAAGATTATCGTCTCGATGAGCGTGGAGATGTCGGTTCCTGG
GTTCGTAAAGAAGCGATGCTGGGTCTCGAGAAGCTGCTTCTTGGTGAAAGCACACACGCGCAAAACCAACACTTTCGCTTGATTGGCGCCACTACACAAA
CAGCCTATGGCCAAGGTACCATTACTGACGCATTATCTGACCGGAAGCGCAAGATCGAAGAAATCAACGGTGAATCCACGACTGACCCGTTATGCTACGT
CAAGTTCGATAAATCAGCACTGGGATATTACTACTTTAGCCCAACAGGAGTGGGGCTTATTCATGCGAAGAAATTGGTGAAAGCAGTTGCTAAAGTTCAA
AGTGACAAGGAGTTTAAAATTCCTGACTTTGAAACGCGCATGAAGCTTACAGAACAGCAAACAACTTCGAGTTCAGATGCTGCCATGCCGTTTGCACGAC
AGTTGTCTCCAGACCTTGTCAGCACAATTGTAAGCTATACGGTTTGCTATCGCCACTGCTAGGTCATTAACTAAGTTCTTTTTTTGTTTGTACAGTTCGG
GGCTCTGGCGAAGCAATTGGCAGAAAAACTGGACAGCATGAGGATGACGGCTGGAAGTATTTTATTCCGACTGCTACATTCAACCAATCCTCGCGTTGAT
GGAATTCCAGACCGTTTTCAGCTCGAGAAGATCTTCTCGTCGACACTTGTGGTGAATTGGTCGATGGCTCATGATACTTTCCCGTTGGTTGTGAAGATGT
TGGACATCCCAGAACTGATGGAGGAAGTTGCCGCGGGTCTTGTCATCAGTGTGGGTGGTCTCACTGAAAGTGTGGTGAAGGCTTCCAAGGGAGCTCTATT
CGAGTGGGTGCGTGCACACTTACAAGCAACAAACTTCGGCCTGCTCACTCGATTCAGCTTTTTTCTGGTGACTTTACTGACGCGACATCATCAGGATGAC
CGCGTTACGATTCCTCTCATGAAGACGATGGCGTTGCTGTTGGAGTCGAATCTGCTTCGCTTTTTGTTCGAGAAGCGTCAAGCAGAAGACGGCAGTGATA
CAAACATTACAGACTTTGGAGAACGTTTGTACTCAGCGTTGCGTGACGAAATCCAAAAATGCACTGCAGTTCCAAAGCTAAGCGCTGCGATAAGTGTGCT
GATTGGTTTACTTCCAAGCGACCCCGAGACAGAATCAAAGACGTTGCGTGCGCTGGTGCTTTTCCTGGGGCACAAATTCCCCAAAGTTAGGAAACTGACT
GCAGAGAAACTTTACACGCGATTTCTCCTTCACGACGCGATTATCGACGAGGAAAAGGTAAGTGATGGCGGTGTTTTGCTAACTTCCCTATTGCGTACTA
ATGAGTTTTAACTTGTAGTACGACACGGTGGTCGAGATTTTGAGCGATACAGCATGGGACGCTTCGGTACGTCGTGTTCACATTCATATTCGAAGCTGAC
AAGTGGCTAACATCGTCTTGTTGATCAGATTTCTCAGGTGCGCTCTGCTCGGAACGAGTTGCTAGAACTCTTTGGCATGGAGCTACCCTCGAAGAAGATG
TACGTTTACTATACTATCCCTTACTCTGTGCTCTACTAACTCCATTGTGCAGGCCTGACCCCGCTAAGTCCAAGTCAGAGCCTTCACAAGATGGTGCAGG
TTACAAAAACCTCATCAAGGAAATGGGCTATTAGCAAGTTTTATCCGCGCAAAAAGAGCATTCGCATACTTCAAAGTACGTTGCAGTATCCCCAAGTGTC
AATCTATCCCCTAGGTCTCGAATTCGTGCTTGTCATCGCCAATGGTTGTGGTCTCGTACGTCACTTTAACTCGACCACCAGTTGCACCTTCACTGAGGTA
GATGAAGACATTCATCATAAACCACGTGAACACAGGACTCCACGACTTCTTTTCCAATGGTTTGATCGCCCCCGTCGGCTTCTGTGTTGCTGTACCTCGG
ATACGCTCGAATACTTGATCCCATGTGTATATCTTGCCAGTCGTTCCCATGTACATGTTGAGAAGATCTTGCTGTAACTCATTCACGCAAGGTCCCGAGA
ACAGCAGACCTAGCTCTGTATCGTTCGGACGTGCACTTAGACTGCGGTCAGCCAGGTTCGAAGACGACCTGAGCGCGTACTTCCCATCCGCAATGAGGAT
GTTGGAATGCACCTTGATCAACACACCGTCGTGTTCTAGACGTCCCACTTGGAGGTGCTGCCACAATTCTTCCGATGTAAGACCGTACGCTGACGCACAA
TCCTCCAACTGCTCCAGTGACCACTGAATTGAGAGCATGCAGTACGTTCGAGCCAGGAACGATGGTTCGTCCTTCTGAGCTGCGTTTGTCAAGATAAGTG
CGTAGAATGGCTCACGTTTACGACGAGCTTGGCTGATACGTGCGACGATGGCAGGGCAGATTCGGTTGTGCTGTAGCGGGCCACCAGAAATCATAATTTG
GCTCTCTAACTGTATGGAATGCTTGGCATTCATGATCATGTTGACCATGCAGTTCTCCTCTCTCCAACCACCAGACACCAGTGGGAACGGTGGAGACTCC
ATGAACTGATCATAGTGGCGTTTGTTCACTGCTGGTTGGTGGTTAGCCTTGATCCATCTTATCATATCCGACGTGCAACGGCAAATAACACTCAGCTCGT
GCCAGTAGTATCCAAGGTGGTTCTTAAGTAGCCATCCTTCACGCTCCGTGTTCACATCACATCCAGTAACCATGATGGTTTCCTCGTCAATACACAGATA
TTTCTGGTGGTGGAAGGCATATCTCGAGTTGTTGGACAGGTAGCGCGTGAACCAACTCGGACCCAGGTCGCTAACAGAGCAAGCAAAATGAACTTGAGGC
GGCAAGATGCGACGCAGATCGGCGATCGAGTTGGTTCCATAGTCACGCACGGGATTGTACAAGATATGCACGTCGACACCCCGCTTCACGGCGTCACGTA
TGAGTGATACAAACGTGTTGTCCATATGCTCCTCATTGGTAGTGTGGAGGACCTGGGTGAAGTCGCAGAGGAACGTCGAATAGTAAATCGACTTACGCGC
AGACACCAGAAGATCCACAATCGTCTCTTGGCATTCGCGGAAGTCACGACACACTCGCAGCTCGTTCGGCTTGGAGCCGTCACTGTCGTTGGCCCAGTTC
ATCTGCTCAAACTTAAAATCCGTCTCGAATCTTTTGCTCTTCCGGTCGAGTAATTCGTCCATCGGTCGATCCACCGCCTTGACAACATTTGATCGTCGTG
CGTCACCATTGCTGCTCTCTGAGTCGATCTTCACTAGTAGCACACACACTCCACAGATCGTGATCATGATGCCACCTAAGAAATACATGAGCGCGTTGTA
GCTGTAGCTGGCCATTTCATTGTAGAAGATCATTCCGCAGCCCATATTGCCAATGATGATGAACGCCTGATACAACGGGATGAATTTTAGTGTACCGAAG
AACTCGAGTCCTTTGTTCAAGAAGAAGAGCTGCGGCACTAGAGCACATGGGATAGCGAGCACCATTAAGATGAAGAACGGGTTGAAGAACACGAGCCAGT
CCTGATGCTTTAGTGACGATTTGGTCACTTCGACGACCGATTTGGTAGCGAGCGACGTAAATCCTGCCATGACTCCTGCGCAGGAGCTAAAAGCCAGCAA
TCCAACCGGGTGACGCTGTAGTTTATCCGTGTGCACGCGTCGTAGTAGCAGCATTGCGTACGCGAGAGCCATGACGGTATATCCGAGCGGGAATACTGAG
TCTCTCATTAACAACCGGCCCAGAGACTTGAGGGTGTACGATCTCTGAGGCACATTGGCCATTTGGGCAGCATAGACATCAACTCCGACGCCTAGGATGA
TCAGAGCGCTGGAGAGCAGGTCGTAGACGCTGAAGCTTTCGTGCAGCACGAAGCGGCCGAGTAGCGCGCTGTAGATGAGTGTAAGCGCCGCAAAAGGAGC
TTGTACGGCCTGGCCGAGGATACCGAGGTTGATGACGGCTGAGATGGTACCCACAGCCAGCAGGAGGAGCCCAGCCAGGTAGGCCGTCTGCATGGTAGCT
GTACCCAGAGATGAGTTGCGAGCCACACGGATATGCGCGTACTTCTGACAGCAGTAGCCACTGGCGGAGAGGAAACTACCGAGCAGCGAGTTGAGCACAC
CTGCGTACAGGTAGGCCGTGGCGTCCACATGTAGATCCAATTGTGGTCCCAATACCAGCAGAGCCAGCCAAGCCACTGTGCAGAAGACACTCAGGATCAC
GGCAAACACGAACCAGCGCGGCAGACGGAAGGGTGGAGGGGTGGGCGGAGAAGACGCAACAGTTAGACGAACGTCACGCGGCAGCAGCGGCGTCAGTTCC
GAAGCCGTCGCCGCGGATGGAGAAGCACGAGCCATCCTTACGTCAGATGGACAAGAACCTTTGTGGATGATTTGGAAAACGATGAAGGATCTTCTGTAAT
CAGATAGAATTTTAGCCAATGGGAAGGCACAATAACTGCTTTATTAACTATAAGATTGGACAGTCAAAGGGTTATTAACTCAGAGAGTACAGTATCGCCA
TGAATATGTCAAACCTTATCCCACCTTTCAAGTCGTCCACAACCGATCTGTGCTATGAGGATACGTGTGAGTCTGC