Description :
From Genome Similarity Track
Location :
contig_4:53996- 55410
Transcript NameFunction/comments
g1052.t1hypothetical protein

Sequence
1414 bases(100 bases per row)
CAGAGTGTTCTTCATCATAGTTGTTGTCCTCCTCGTCCGAATCACTCGAGTTTTGCTGATCAATCGCCTGAGGTTGGTTGGAAGACGCCTGAGTGTACCG
ATACCCAAACGACGACGACGCTGGTGGAACTAGATGGCCACTTGAGCTGTTCTCTACAGCGCGGGACATTAAATACGTGGGTGAACACAAGCTGTCCTCG
CACGACGAAATAGAATATAGAAAGCACTTACTTTCGCTGAATGGGGGGAGCTCGGGGCGCCGCAACGCCCAGGGTAGGAAGCCGGGGGCGGTGTGTAGTC
GTGACGAGAGGGGGAGGATGATGCCTCAAAGTTGGTCGCCGCAAAGTTGTTATCGTTGTTCAGGCTCTGGTGGCGTTTGCGATTCGGGTGAGTACGCGCG
TTGTCGCTGCCATGAAATAGACCCTCCAGGTCGTCCAGACCTGCACACGAAAGGCTTCTCTTGGGCGACGGCCTGCGAACAAATGGCATGCGTTAGCCTT
CACCGCGCTGTAGCCAAACAAAGAGGCCCGGACAAACCATACCTGCTGAGCGCGGAATGTGGGTGCATGCCAGACAGGATGCGAAACGAGCGGACTCGCG
GAGGGTGGGGCGGATTGGGACGTACGCAGATGTCGAAAGCTACTTGCAGAACTCACCAAGACGAAGAATACCACCGGCCATATCCTTGGCAGCCGTGTGC
ACCCTCGCGTTAGCTCTGGCAAGTTGAGTTGAACAGCTCTCGTGCTCTCCTCGCTTGCGAATGCGCTTTGGAGCTTGAGAGGAGGCTGTTGTCGCTTTTC
TTCATCGTCGCACAACTCCCAAAACAAACGAAGCATAAAACACCAGCCAACGCAAGGGCCCGTACAAAAATAGTGGCGAAACAGCGGGCCCAACAGCTCT
TCAATCAGGATTTCTCCGCCACCCAGTCCAGACAATTATCATTAGCGCAGAGGGCTTCGGAAATCTGACAGACAAGGCAGCCATCGACATTGCTCGCTGC
CTCAGTCGTAGGATTAGTGCTGCTATACATGAAGGCCACCTATCTATCCACGCCAACCAGCAAGCTTAAACTGGCATCGACAAAAGAACCAAAGCAGCCT
TCTTCTTTCCGTACCCTGCAACCATATACCCTGCAAGACAAACACAGCATCTTCAAGTACTCGCACCTTCATTCTTTTCAGACTTTGCAGTGGCTGGGCG
ATTCCTTGCACACCGCTCTTCCTGTGCGATACCTGTCTCCCTCCGTCCTGCAGCGGTTGTGCTCTATGCAGTTGGAGTAATATCGCTCCGACAACGCAGG
CGCCGACACGATGGTCCATATCCAGGACTCCCGCCTCTCAGCTGCTATCCACACCCTGAAACTCTGCTTACTCGCTGGGAATGCCAACAGAGCGCAGCTT
CTCCTCGAGCGTTC