Description :
From Genome Similarity Track
Location :
contig_143:53985- 55435
Transcript NameFunction/comments
g14293.t1hypothetical protein

Sequence
1450 bases(100 bases per row)
AGTCGCCCAACGTAAAACGTTGGGTGCAAGCGCATGCTGGACGGTATGTCCAGTGTGTACGCGTTGCCATGCTTCGCCAACACGGTGAATGGCCCAATGA
AGCGCGGAGCAAGCTTGCTTGCTCCGAAATCGGAAACTGCATGTTTAGCTAGGTTCTGCGTAGCTAACAGAACTAATGAACCAACTTTGAATTCATTTGT
GTTTCCCCTGCCGGTGTTATCGGCATTCAGCTTCTGTCGATCGACAGAAGCTGCTATTGCATCTTGGACAAACCGAATTACGGCTTGTCGACGCTGGACA
AAGTCCATTGCATCCGAGCTGAACCCCTGGTTCAGTTCGTGCTCCTTGTTCGCAGCAGGCCCGGCCTGCGCGTGATGTTCGTTGTCGTTTAAAGTGTCTA
CGCCCGTCGTAGACACTGTCTTGTCGTCGCCATGACTGCGCGCAGTACGTGCGCGAGTCGTCACAGCTGATACATTGCTTGTATCAGCGTGCTTATCCGG
TTGTTTTGAATTAACCGGATATCCTCCCCCACTTAAGGAAGGAGCTACCGCACCGAGTACGCTCGGTACGCGTGGGTGCCTCATGGCATTCACGTAGAAC
GGTGTGTGTCCTGTCGAGACATGCACCGAGTTGTTGATGGCGAACTCCGCCATCGGCAAGCAGTCGCTCCATTGATGGAACGAGTGCGCGTAGCTCTTCA
TGGTGTCAACCAGCACGCGGTTGACACGCTCTGTTTGTCCGTCGGTCTGCGGGTGATCCGCAGTCGACATGGACAACTGCGTCCCAAGAAGTGTAAACAC
TTCTTGCCAGAATCGCGCTGTAAAGCGCGGATCCCGATCCGACACGATGTCGAGTGGCATACCATGGTGTCTAAACACCATGTCGACAAACAGACATGCC
GTCTGTTTGGCTGTCACCTCGGCTGGTACTGCAGCAAGATGTACCATCTTGCTGAAGCGGTCAACAAAGACCACTATACCAGTCCTCCGCTTGTTGTCTT
GCGAAAGAACAAAAACAAAGTCCATTGAAATGGACTGCCAACACTCCGACGGAGTCGGTAGTGATTGAAGCGGAGCCTGCGAGTTGGGCGCAGGCTTCAC
GCGCTGGCATACCTCGCAAGCACGAACGTACTTGCGTACCCATTTGTACTGGTGACTCCAATAGAAGTCACGCGAGAGAAGCAAGTATGTCTTCTCACGG
CCAGGATGTCCCGATGTCGGGGCATAGTGATACTCGTACGTGATCTTGAGTTTCAACTCATGATCATCCGGCAGGACAATGCGATCTGCGTTGTCGTCGA
CTGCGCTGTAAAGCAGCAGACCATTGTGTACACGATAACGGAGTACACGAGCACGAAGGTGTTTTGGCCAGCTTCTGACGAGACTTGTCAGAAGGTGTGG
AGAAGTACTCCAACAACTGCTTCGCATCCGCATCATGTGCGTATGCGGCC