Description :
From Genome Similarity Track
Location :
Scaffold_10:53984- 54987
Transcript NameFunction/comments
Phyin_T30-4PITG_06707HECT E3 ubiquitin ligase%2C putative

Sequence
1003 bases(100 bases per row)
ACGAGAGTTAGGTACGTGACGAGCTCTTCCAGTGAGCGATAGACCGGTAGATCCAGGCGGTTGAAGCACGTGTGAGCTTTCGGGTAGAGCCCAGCTGGAG
GAGCTCCAATTGCCACCATCTGAAGACCGAAGCGACGGATACGTCCGTCGTGGCTTAGCAATGCTCGGAAGCCTTCAGCCGGCACACGAGAGGTGCCGGT
GACGAACTGCAGTAGACGTGCACGTTCTTCCTGCGAGAACCCACGCACAGTGTCCCAGAACCACTTCACGACTTGGCGCTCTGCTGCCGCCGGTTTGTTA
GGACCCTGCTCGGCGCGCATGTAGCGGACGTCAGTGTGGGATTCCCAGTCGGCGACGTCGATTGACGGCACACCGCACACAAGCAGCTCCAGCTCTTGGT
AATCGAAGACCGCCAGGAGTGTGCGTGGCAGGACGTCGTACAGACCTTGAAGCAAGGCCTCGAGCTGCTCCCGCACCGCACCAAACATCTTGTGCTTGAG
CAACAGCGTCAGATACTCTTCCTTATTGGCATCTGTCACGGGAATGTCTTTGCCTCCTGCTTTGAGTTCCTCTGTGATGATGGATCCGTCATTTCCCTGT
CGTTGAGCTGTGAAGTCGAGGGCGAGAGCTTCGGCGCCTTCATTGTCCCGCAGCCAGAGTGCGTGACGATGGAGTTCTGCATCTAGGAATTCAAGGTCAG
AGAAGGAGATAGGCACTCCCAGTAGATGCTTGAGAAGCGGAAGTGCCAAGTGCACTGTCAACAACTGTCCTTCGAGCATACATTTCGCCAGTAATCGCCC
AATGAACTGGAAGCAGTGCAAGTGATCGCGATGGATTTCACGCGAGTTCGGGTTGATCCAGTAGCCCGATTGGTCGGCGTGTGTTCGCTGGAATAGTCCA
TAGCTCTCGTCAAAGAGCTGCTCGCAAAGGAGTAGAACCCACTCGCGCAACAGACCGCCGGCATCTAACCCAGGCTCGTCGATGAACTCGATTCGTAAGC
GCT