Description :
From Genome Similarity Track
Location :
Scaffold_204:53971- 57023
Sequence
3052 bases(100 bases per row)
TGCATTAACGCGCAGCCGATTGAGAATTGGCTGGCGTCACAGACCACATGGAATGGTCTGTCTTGGTCTGCAATCGCCAAGATAGGCGATTGCAGCAAGC
TCTGCTTGATACCTTTAAAGGAACGCTGACAATCCGCGTTCCATGATTCCTTCTCGTTCTTTTTCAAGAGACGAGAGAGATGAACGGTCATCTCAGCGTA
GTTGCGCGAGTGCTTGTGTAAGTATGCCGTTAGACCAAGGAACTTTCGTAGTCCCTTAACGTCGACTGGCACAGGCCAGTCGGTAATCGCCTTGATCTTT
TCAGGACCAGGGCGTATGCCGTGTTACCCACGATGCACCCAAGAAGTGGTATTTCACTAGCCGCAAATATACACTTCTTGAGGTTGGCATACAACTTATG
CTTCCGCATAAGTTGAAGAACCTGACATTCGTGTGTTCTGTGAACTTCCACGTCTGTCTTCCCATCCATAGCCCGGCTATGGACGAACACATCGTCAAAG
TAACTCGGTGCGAAGTTCCGCACCGGTCTCAACAGATTTGTCACACATCTGTTGAAGGTGACAGGGGCGTTACTAAGCCCTTGTGGCATTACTAGCCACT
CCCACAGCATACCGATGGGGGTGCTCACTGCTGTGTACGGGATGTCCCGTTCACGCATTAGGATCTGATAGAAGCCATCCATCATATCCATGGACGAAAA
GATGGTACCCTTTGACCTACCATCAATGATTACGTCCTTCCTCGGTATCGGCGTCTGAACCGGTACGTTGCAGCATTCAACTTGTTGAATGCGTGCACTA
TCCACCACCATCCTGTGGCCTTGCGCACACAGAAGGTCGGAGAGCTGTGAGGGGAAGTTGATTCCCTCACATGACCCGCAGCTAAGCCATCGGCAAAGAA
CTTGTCTAGCTAGTACTTGTTCACGAGGCAGTGGCCACTGCTTCATGACACTATACTTCGAGCCCGGTTTGAGCTCGATCTCGTGTCGAGTGCCTTTATC
CTTAGGCAATTCGCATGATACGGATTCAGGTAACACATCCTTGAATTCGATCAAATCCTTATACAAAGGATTTGCCTGAAGCGACTCCCAAGATTGAGAC
GTGTATCGTTCAATCCGAGTCTTATCATCGAAGACACTTTCATCCATAGATGAGCTGCTGAGAACCCGTTCATTCTCAGCAAATACTGTTGCCGACCGAA
TGTCAGTCACGTACTCATCCTCTATGACGAGTATGCAGATCTGCTTGACCTTGCCACTACGCAGATCACGCAATAACCGTTTCGGTTATAGCTTTGGCAA
TTGAGTTATCTCCGAAGTCGACTTCGGAGGTGCGATCAGATCAAGTGTATAAGCGCTTGATCCGTCATTAACCAAGACATTCAATGTCTCGGTTTCTTCC
TGGGAACTTGTTTCCTCAAGTACGTGTGGACTTATTCCCTCGACGTCTTCTAGCTGTGGTTGCGCTACCACAGCTATGTCCTCTACGAACGACTCTCCAG
CCGATCTAGGATCATCTTGTTGCCTTGTGTGGGCAACCAGTTTGTTATTACTTGGATATCGCCCGCTAGGCGTACAACCATGTCCCGATCCACTCGACTT
ATTCGAGTGGTGGAACTTCAGCGCTGCCTGTACTCCTGTACAGCCGCCGGGATCTTTCTCCACAATGTAGGGATCAGCTACACTGAGGTCTTGTGCAGTC
GTACTAACGACCGTACCGCAAGTGAGGCCATCGCACTCACTCGCAGTACATCCATACGCTTGTGGACGCTCCAAGACGTTCATCAGATGGCCATCTGATG
AACAAGCGGAAGGCATCTTCACGGATCGATGCTGCCAGCTCAATCTTGGCTCGTATCTTCTGAGCCAAGGTAATCCCAGGATGACATCAAATTTTGTCAT
CCAGATCCAGTACGATGAAATCATCATCGTACTGTTCACCCTCTGACGTGTAGTGGATTCCAACTACACGTTTCTCAACGGTTATCGACGTGCATGTGGC
AAGGCACACCGTCATCATCGTTTGAGGGACGTCGCGCTCAACGAACTTGATCCTACGACCCTCTAGCGACTGACGACGAACAAAGTTGTTCGACGCCCCA
CAGTCGATTAGAGCACGAAGTGAAAAATCGTTTGTCACTTTTAATTCCAAGGTGATTAGTGATACCTCATCACCAGGTGCAGAGACACACAATGATGGTG
TAGCTGGAGCAACTTTCATCAAGAGATTTGCAAATTCTCTTGAGGTTGCTGGATCAGTAGGGCGCTCCGCCCCTACTGACCCCGACCATTTTTTGACGGT
CCACTTCGCTGTTGTGACTCCGCAACAGCGTCGGAACCGCGTCCGTTGCCCTTCTTGCAGACGGTCGATCACTTCGCTCAGTGTTACGAGACACTGGGCG
TGGGACACTACACTCGTACGCGTGGTGTCCCAACTTCTGGCAGCGATTTCACTTCTGCAATCGCTTGTTGTTTGAACAGCGAGGTCTCTCGCTCTCGACA
TAACACAGGTCCATTGGTTCTGGACCTCCAGTCTCTTGTCGTCTCGGTGGATGATAAGAACTCGAGCTAGCATGAGCCTGTCTCATGCTAAAGTCCTCCT
GTTCCGCAGCTGAGATTTCTTGTTCAAGCGTATCCAACTCTAAGCGGAACAGGTGGTTCCTGACGGGCCCATCTGCGAGCCCTTGCATGAACACAGTAAT
CAAACGTGTGTTCATGTACTGGGTTAGCAACTATACTGCTCGCGAGGAGTCGTATGTTTTGAGCGTAAGTGTACACATCACTCTTACCCTGCTTGAGTTT
CAGAAGCTCTGATCGAGCCCTGAACTCAGCCCGTAGCGGCTCAAACGTCTGTTTGAGCCGGGTTTTAAAGGCTTCCAGCGACTCAAAAGCATATGGGTCG
CTCATTTCCAGCCCTAAGGCCCAAGTATTGGCACGTCCCGCCGAGTGGGTTTGAGCAAATGTGAGTTTCATTTGCTCATTGTCGACACGTCGTGCCTTTA
TGGCTCTGTCTAGTTCGACGAACCATAATAACAGGGAGTCTTCCTCGACTCC