Description :
From Genome Similarity Track
Location :
contig_24:539705- 541824
Transcript NameFunction/comments
g5460.t1POM74471.1 Integrase catalytic core protein [Phytophthora palmivora var. palmivora

Sequence
2119 bases(100 bases per row)
GTTCTGCTCCTTGTCGAGTGCCTCAATGTTGTTGACGTGCTGCGTGGTCGCAACCACCCTGTCCTTACTCGGTACCCCTTGGCTCTTCGCCCACGCCGAC
AACCATGGCAGGCTGGGCACGTTGCGCGAAATTCTTCTTGCGCGAATCCCGGTAGACCGTGCACGGCGAGCCGAATACGACGATCTCACCCAGCTGCGGC
GACTTGCCCGTCAACACCTTCAACGGCGACGCACGCCCTGGGTTGGAGTTAGTCGGGCGCGGTTCAGAATATACGCACCGTACTCAGAATGTGCGCACCG
TACTGGACCGCGTCACCCCAGAACTTCAGCGGGAGCCCACACGCGAAGATCATGCACCACGCCATGTTCATGATGGTGCGGTGCATGCGCTTGGCCTTGC
CGTCGCTCGAGTAGTTCCGCGCTTCGCTGCGCTGTCGGGTCACGCCCGTGCGTTTGCAGAACAAGTCCACGTTCTCGTACTCTCCTCCGGAGTCCGTGCG
CAGAACGTGGATCTTGCAGTCGAATTCCTTCTCGAAGTAGACGAGAAAGTGCTCGAAGAGCTTCACCGCGGCGTCCTGGGTACGCGCCAGGAACACGTGG
CAGTAGTTCGACTTATAGTCGATGAAGTTAATCATTTACCCATTCCCGAGGCAGTCCTCGGTCGTCATTGGCCCTTTCAGGACGGAACAGATGACCCCAC
CCGATTGGTGAGTGGGCACCGGTGTCCTTCTTGGACCGCCGGTTCTTTGTCTGCTTGCCTTCGGCGCACGTCAGTCAGTTCATGCGCTTGTGGCCCATTA
GGTGGATCCCGGATCTCGGCTCCTTAGCCAGTCGCTCCGCCGAATCGTAGATCAGGTGCGCCAAGCGCGTGTGGAAGTCCAGTAGCGCGTCCTTCTACAC
GTCGACCGACACTTCCACTGACTCGGCGAGCTCCTGGTATAGCACGGCCATAATCACATCCGACGGCAAGTCATGCCTTCGCCTCATGGCAGCGGGCACG
ACCAACACGTTGCGCCGCATCTCAACGTCGAACGCTACGCGTCCACCGTCCTTGGCCGCAACGACGCGTCGCCCGGCTCGCTGGGTCAGCTCAAAGCCTC
GGTTATCGAGTAGCTCATAGGAGATGAGGTTGTGCTCCACGTTCCTCGCAAAATATACATTGGTGATCTCTACCATCTGCTCCTCACCGCACGCCGTGAT
ACGCAGCATCACCCTACCACGCTTGGTGATGTTCAGCGACTCACCGTTGGGCTGCACGCACTCGTCGCTGCACTCTTTGACGTCCTCGAGGAACGACTCG
TCGTTCACGAGGTTCACTGTCCAGGATTGAGAGACCGTCGTACTCGCCGGACTTCTCGCCGACGGCCAGCGCGAGGTGCGCGCGCTGCTTGCGGTCCGGG
CACGCTGCGCGCAGGTGACCCACACGGCCGCACTCGTAACAGCTGCGCGTCTCCAGGCGCTGGTTGTTGCATCCCCTCACCGCGTTAACCGTCTCGCGGC
CTAGCGGCTTCTGCTTGGTCGACTCGGTCTCCCAAGACCGTTCGAAGTGCGCGAGCTCCTCGGCGTGCCGCAGATAATCGGTCCTTGCTTGGTCCACCTT
GGCCATCAACACCGTGCGTAGCTCTGCGGAGGCGTACTGAACGATGGTGTTCAGCACCAGGTACTCGACGTTGGTCCGCCTGGACTCGGAGATGGCCACG
AGGTACATATAGTGCTCGGGCCACGGTCTCTTGGTGTCTTTTGACGCTGTGAACATCTTCATGGCTTGGGCGGGCGTGATGTTCGTCTTGAACGCGTCCA
GTATCCGCTCCATCACGTACTGCAGCGTGGGCAACTGGTTCCACCACGTGTCCACCTGCTTGTTGTAGTATCTCTCGGTCGTACCCGACAGGTAGTGGCC
GAGATGGTCTACTTTCACGTCCTCCGGTCACGGGAAGCCGCACGCCTACTGCCCGAGCGCCACCTGCCGTTTGAATCTTCTGCCTCAGTCCAGGAAGCCG
GATCCCAGCCCGACGTACAGCTCCACGCCGTCGAACGGACGGATCACCAGCTTCTTCTGGCGGGCGTCCGGGTTGCGGAACGCCCCACCCTGGTTCTGCG
TAGGGATGGCTGGTGGCTG