Description :
From Genome Similarity Track
Location :
Scaffold_72:53965- 59839
Transcript NameFunction/comments
Pytap_DAOMBR444fgenesh_masked-pag1_scaffold_72-abinit-gene-0.156MGC89050 protein isoform 2
Pytap_DAOMBR444maker-pag1_scaffold_72-fgenesh-gene-0.23Ubiquitin carrier protein
Pytap_DAOMBR444maker-pag1_scaffold_72-snap-gene-0.47Conserved gene of unknown function
Pytap_DAOMBR444maker-pag1_scaffold_72-fgenesh-gene-0.24Transcription initiation factor IIB
Pytap_DAOMBR444maker-pag1_scaffold_72-fgenesh-gene-0.25Novel protein (Zgc:73376)

Sequence
5874 bases(100 bases per row)
TCGAACTCTTCTTTGTACGAGAGTTCGCTCAGTGCATGCGCCGGCAGGTTCATCCTGGCCATCGCCAGCTTGAGGAATCCCTAAAGTACAATGCGCCATC
AACCATCCATGCCGTTTCAATCGCCgTCAGATCTCCATTCGCCGCGCCGCGCCCGCACCTGCTTGAGCAGCTCAACCGCATGCTGCTGGTCAGCCAGATA
CTCGTCGTAGAGCTCCATCGCACTCACAAGGCGCTCGTCGTGTGCGCCAGCGTCCGCCATGATCATGGACCAAGATgcgAagtggAaCCGCGTTGTTTTA
GAAACCGTTGGGCGCTTGATAGAAATGATACAAACCATAGAAACGCcTcTACCCACCAAGCGGCATGCATTTCAGACGGAAGAGCAGGAGACGATCATGG
CGATGAAGCAGATCTCACAGGAGACGTTCGACGAGGCCGTGCGCGAGAACGTGGAGGACTTTGACATGACGCTCGAGGACGCTACGCTGGACGCGATTGC
GCAGTTTGAATCGCAGGGCGTGGACTTGTCCAACATCATCAAGCGCGTCAGTGACTCGCCTGAGGACGGCGCCGACGGAGCTTCCCAACTGCAGCAACTC
AAGCGCGCAATTGAAGCGATTCAGGTGCTCGCAGAGCAAAGTgAaGTGCACCGACAAGAGGAGAGTATCGTGGTGGCGCTGGATACACTGaCACAGATGC
TGGAGCAGGCGCCAGAAATGAAAGTGATCGCGGGGCGCAATGACGCCATTGACCCTCTCGTGACGCTTCTCGAGTGCAACAGCGCTGTGGTTGTTGAGAG
AACGAGCGCTTTGTTGACAGTTCTCAGCACTGAGAACACGGATAACCAGGATTTTATTGGCCAAGCTGGTCTCGAGAAGCTCGCGACGGCATTGACGAAG
GACTGGGCAAGTATGACGACAGTCGGGCGGCTGCTCAACGCCACGcGGGTTGCTTGTACGAAACACGAGAACAACAAGGCACATTTtGCGAAAgCGCACG
GTGTGGAaGCGcTCTGTACGTATCTCCAAAAGGCCAAGGAgTATGACACATTGTCTAAGCAAGTGgCGGCGGCTCTGCGCGTTCTCACGATCAATGATGA
CCcAAAGGCCACGTTTTCtCAGGCCCAAGACACAATCAAGTTGCTTGtCGCGCAAGACATaaTCCcTTACATCATTGGCATCGTGCAGACGCGTCGGGAC
CAGCCAGAACTCCTCACTGCATGGCTCATCGTGCTCAAGCAACTTGCGATCACAGAAGAACACTGTAAGAAGATCTATGACCTCTCTGGTCTCGATCTTC
TCTTCCgaGTCATGCAACAGCACGAGCGCAATCTGCCCGTCGTGAAGCGCTGCGTGACCGTGTTCCGTAATGTTGCGGCGGCGGACGAACTCAAAGAGTA
CATCATTACGTCAGGCGGTGCAGCACAGATTCTTGTTGCCATGCAGAACCATCTCGGAGACGCCTCGATGCAGCAGCATGCTTGTGCAACACTCGCAGCA
ATCGCTTTGCGCTCTCCTGAGAATAGCAAGCGCATTGTAGACCTCGGCGCGGCTCGACAGATCGCATTTGCGATGCGCGCCCATACGACAGACACTGCTC
TCCTGCGCCAGGCGAGTCTGGCGATTCGCAATATGGTGGCACGATCTCCCGATCTGCGAGGGCGtATTCTCGAAGAAGACGTCGAAGAGTTATTGCGTGA
GGCACAGCAATACCGAGGGTGTGGTGACGAGGCGTACGCAGCGCTGCGCGATCTGGGCTGCAATATTCAGCTGTCCTCGTTTGGCACAGGCGCTCAGCCG
AAGGCTCAGTTCAACCCAGTCAACATCGAGTCTCGCAAGCTCATGGACGCGGtGGAGGAAGCGGCCGAGGCGCCGTTTGCACACCATGCGTGgAGTAAGT
GACAAGAATATACACGAGCGTTTGCTTTGCTTTACGATTGTGACTTCCAaCTGTTGACTAGCTAAGGTGGTGGTGGTGGTTTGTGTGAATCTAAaGACGA
CGGCTGACTGCTACCTGATCACCCTTCCTCCATGGTCGTTTGCGTGGGCTCGTGATGTAGTGCGACGACATGGCCTCGCACGAGTAGTGACTTTGCATGT
TCGAaGACGAGGGTGAGAGACGACCTCTGCAGTACAAACTGACAGGGGGTGTTGAATGCGgCAATCCTTACGAGaTCGAGACCCAGCTCTGCTCGACAAT
CTCACGCACTCGTCGGTTGTATTCGCGTCGGTTCTCCTGGAAGAGGCGAGCAGCTTCGGAATTCGCGGGCGAGTTCGGGTTCGGATCGCACAGGAGCGAC
TGGATAGACGTCAGAATGGCCGAGATGTCATAGATTGGCGACCACTGGTTCTGCAGAATaTCCAAACAGATCTGGCCGTCGTTGTAGACTGCACGCACCA
CCATATCCACGGTTAGTTaCCCAATATCCTTGATCAGGTCACGCAAAAAaGTGGCACATACTGTTTGGGTGGAACATCTTGGTGATGAACTTGACAGTTG
GGGCCTTGTTCGGGTAGTCCTCGCTGAACTCGAGCGTCAGATTGAAGGTGCCGCCCTCCCACGGCGTGTCATCGGGTCTGTTCTCAAGATCGCTGTCAGT
TCAAAATGCGTCTCTCTTCCCATCAGTCAGTCTCGCCACGCACCCAAAGATCACGGCTTGCCACAGCATGATGTTGTTGTCCATGGGCGCTCCCGACACA
CCCGACGGGGGGTCGTTCTGCAGCTTACGGAAGTCGCGCATGAGGCGGCGGCGCGCGGCGGTCGACATGGCTCTTGCTCGGGTGCTTGTGCGGCGTCACT
TGCTGAGCTGCTCGCCCACTTCCGCCAACGGGACCGGACCATCACTCTCACGTCGGCGAAGGAAAAAAaGCgAAaGGAAAAAaCCTCGATCGAGCTGATC
ATAAAACCTTGTCCTTGAGGcACATCAGCCCTTCCAGAATATACCTTGATTcGTACATCCTTTTCTGACTCAGACGAGGAAGATCACACCTTGTAGTGTG
AttgtCATCGTTATTAAGTCTtCGACGGTACTTCTTTtGAGGGATCTGCATTGCGACCTTTCGTGATtACaGGGgTCAAAATGCACATGCCACTCGTCGC
AGCACTGGCAGACCTCGCGTATCTGCGACGCGCGCCGCCACCGATAACGTAGAAGGAAGGTCCAAAAaGGATCTTTGGCTCTGGTATTGGCCTGCTATTA
TTAGCGGTGCGGACAACACGCCCGAGTGAAGCTCTGGCACGCGGCGATGTCGAAGGAGCTGCTTGTGAATGGGGAGACGAAGGAGATTGTGctGGCCAAA
TTGGAAGCTACGGGGCTCAAGACCATCTCTGCGTTCTCTTCGGCTTATGATGACAACTTCCCGGACGCaCTTGATGGGATCAGTACGTAGTCCTCACGGT
GGAAGGTGAATGTGTTGACACGGAAACTCcTGTCGAATCTAGTCTCGCGAAAGGAATTCAAGTTTTGCTTGACGTCATCAACCAAACACTCGAAGACTAC
TACCCGTGTGTCCCGTGCTAtGCATGCGGGTACTTTTGCTGTGCCATCTCTATGGGCATGTCGTTATTTTTCCCTGAGCCTtGTACGAAAGAGGTGCGTC
CAGAGAGTGTAGTATCTAAGTGATGAGGCTGCGACTCACGACACTCGTATGCAGCTCGAGAACAATGTGGATATTGTGCTTCGCCGCATCAATAACCGCG
AGGAATTTCTGTATCGAGGTATCGTCTGGAAGCTGCACCGCAGCCCTCGCACTCATGCGTCGTGGTTGGAGATTTGTCAGCTTCTGTAcGAATGAGTCAC
TGTAATCgAACGCCACGAATTTTGtCCGAGTCGTGTGAGTAAGAAATGTATTCTAAGATGCTGCGCACTGCCTTTCTtGTCTACTGTACGGAGGTGCGTT
GACTAGCATATCATCTACTGGTACGTCTATGGATTGGGACACTGACTGAAGGTGCTAACAGCCAACTCACCATTGAATGTCCTATATAAATACTTACGGT
GGTCCTCGCACGCTTACTCTGACATCGTGGATGACACGCGGGTATGCGGAAATGTAGGagAGACCACGCCATCTTGGTAATGGAGAaGATGTTAATATCG
TCGAATCGTTCAAGAGAGAGTCACGCCTTCAAACAGCATCATTCGGCTTTTGTTGAGTTCCTTGCAAACGACCTTCATGTTCTTCTCGCCGATCATCGAG
ACATCACTGATTTCTTGCAGTGATCGCTTCGAATCGGTGTAGGCGGCAACGAGATATATCACTGAGGCAGCTACGGCAATTGGGGACTTCCCTGTAGATA
AaCCGAGGGAATCcGCCTTCTTGGCCACTCCGTACGCGATCATCTGGGTCTTGTTCGGAAGCCCCAGTCGAGAGCAGAATCGACGCACATAGTCTTCGGT
AGTTGCCTGCGCCATCTCGATGTTCAGGTTCTTGTTGAGCATCATGAATGACTTCCCAATGCGTTTCTTCGGCACGCCACTCGCTGCTTCAAACTCCTTT
AGAGACCTCGCATTGCCAGTTTTtCGGCACGCGATGAACAGCACAGCCACAGGAATGCTATCTTTCTCCGGTCCACGCATGCTGATGCCCTTCTTTtCGG
CGTCTGCGTACACATCGAGTGCTGCCTCAACGATATTCTTGGGTAGGgCgAGGGACTCGGCGACCTCTTGGATCTTATGCATCATGCCTTCCATGCGCCG
CATCTTGCTAGACTCCGTCTTGAgTCCcGGGcGTCGATGAGGGCGCTCTCCATtcGCAGCAGAGgAgCTCTtGTtGGCGTCGACGAGGTAAGTGGTCAGC
GAGATGCTATCGAGGCGGCTGTCTACAGCTTCTCCGACCCTGGATTTCGCAgCGGGGTcGCCCCcGCGATCGTCGTTAGCATAATTTCTCCATTCCGGCG
AGTCATCAACAATTCTCTCACCGAGgATCATTCCGCATCCGCGACAGACGATATCGCCTGCGCCGAAGTCGGTCACGACGTCCGAGCTACCGCATGCGCT
ACAGCGCTCCGTGTAGCACTCGGcACCCATGGGAGAGTGGAGTGGGAGACGCACTGAGGTCGCTTGTGTAAGGCAGGCAGCGTGGTGAGAGAATCGGACA
GCGTAGCGATCCTCGCGGGGGCTTTCTCGGTCTGTGCCGCTTGCACTAGCATGCAACGGATCGCCGCTGGTGAAGGGTTTCCAGGCTCCAACGATCGCAT
AAAaCCTAAAAACCTCGATTCGAAGAAATGGGTGGAAAATTCGACAGCGAGTAGGCGTTAGTTATGGAAGCTGGGTGTTAGATATGGAAGAAAGCAAGCg
AAAaCATCACATCGGCGCAGAATAGCACTTGATGGAGAGGGAGTGACGCGTGACCAATGCGGTGACGTGTTTGGTACTACAGCAGCGCTGACTGTTtCGT
GAGGgAAGTGATGgTGaGTaTTACCGCTGCATGTGGCATTGAATGCCCcTcGgAATGCTGATAATCAATGGTCTGACATAGGCCGTTGTtCcAcGCAAAT
GGCAACGGaGAATGCACGAGCGTGATAAGCCAAATCAATTTtCTTGTTTCTACTACCTGCATCTGCCAGCGAGTGGCTGAGTGTCGACTCAAATCTTCAA
GCCcTTCTTTCGCAGGTCCTCCTTTGCCTCgaTAACTTGGCGATCAAGTtCCTTCGCAGCTTCGGGgCAGTCCGTGACAGCCATCACCGACATTGCGATC
ACGGCGAGCGAGTACGcaCCAAAAGTCACAAGCGCGTACATTGGGAGCACGTAGACgaCTTGAAGCACACGCTCGTCCGCGACACTCgCCGTCGCAtACT
TGATCAGCAGCAGCCACAAtGCGAGCGCCGcGgTGAACGCCACGAGCCACTTCTGGTACTTGAGCATGTCTGTG