Description :
From Genome Similarity Track
Location :
Scaffold_270:5396- 7002
Sequence
1606 bases(100 bases per row)
AGTTTTAAAAAAACTCTATTTTCAAATCGAATCATTATGGACAACTTTACAAAAGACCAAATCTGACTTGATTTCTGTGTGGCGGTTGTTGTCACATTGG
GGACCCGGAGGGTTCGCAGCTTGAAGGGGGAAATATATGGAAGCCAAATTTATGGAGATGGCTTGCCAACTCATTACCAAACTGGCCAATCTGACTTTCG
AAGAGTACCTAACAAGCCGGTTAAACCTGTATTGAAGGAACTACAAGGTTTTGCGTCCGCATCTGTACTGATAACATTTACCTAAATCATTGAGCTGTCT
CTCAGTTTGACCTAGGGAGGGGGCCGGAGCGAGAGTGGTGTCCCGGCTGGGATTATAGTATCACCGACAACTTTGTTATTGTAGCTCATGGTGCCGCATA
CAATGTACCCTTCATCAGGATGCAAGACCTCCCGTCGCACGTGAAGCTCCACAAGTTTCTGGAGCACTCTTTTGGTGAATATGGAGCCCAGCCGCCCACG
CTCTCCTCGACCAAGCGATCCAGCACGTAGCTCACAGGTTTGGCAGCGGTGCCTGCTTTCCTGGTAGCGGAGAGCCAGTCGCGCCATCTagcgactcgag
ctgcaacTCTTGCGGTCGGACCAGGTTGCCGCAATATTGGACGATTGCGGTATGCAGCGAAAGCGGTTAATGTCGCGCACTCGTCCGTCATGGCATAGTA
CATGTCGTAGGCGCTTCTGTCGTAGTTCAGGACCTCGTTGCCCCTGATCAGGAGTGGTTATGTGGAGAATGTTGTCCCATGGCATCCGAAAACGTTCCTC
AACGACAGTTCTTTAAACTGCTAATTGTGCTGAAGAGATCCGGCTTCATACTTCGTACGAGGATATATCCATACTCTACTAATTTCTGTTCGAACGTAAG
TCGTGATACAGGTAGTTTGCATTTGTTAGCAGCGGCACTGGAGATGCTAGAGTGGAAGTGCATACACAGGATGGAGGTGGTCACCCCATACCAGACACAA
AACATCTATAAACTCAAAGCTAACGAGATGTGGATATGGGCAGGCAAGGACATGAAGTATCGAAGCACAGACAGCAGGTGCGGGAACAGCTTAACGCATG
GAACAATACACCTCGTATGGGAGTGTCCAACAGCGCAGGAGTACTAGCAGACATTGCTGAAGCACTGAGGCAGGGTGAAGGAGATCTAAAGCAGTGATGG
AGCAATAAGCGAGGACGAGAGGTTTCAACTAACACAGACGCCACGATAGCTTACTCAATAGAGACTGGAGCAACGAGAGGGGTTCTGGGATATATTATAG
CAAGTCGCAAGTGAGACGTTGGTAATCGGATGCGTGGTGCGCCTGACGACAATTTGGAGGCGGAATGTAGACAAAGCACACAAATCAGGCACGACAGAGA
GGCCTGGTACATTCTACACGGACGGATGCCGACGAATGGTCATGGAAGCTTTCGGACGATACAGACTTGGGTTTTACCCGCTCACAAGAGCGTCAAGGGC
TAAACTGAGCATTACAGAAGAGATCCTGCGGAGGTGGGGGCAAAATAAGGACAAGGAGACAAGCTGGACTGAGACCAGAGTCACACGGGTGTAATTCTAT
TATAGC