Description :
From Genome Similarity Track
Location :
contig_24:539595- 541761
Transcript NameFunction/comments
g5743.t1hypothetical protein
g5744.t1POM74471.1 Integrase catalytic core protein [Phytophthora palmivora var. palmivora

Sequence
2166 bases(100 bases per row)
CTCGTGGCCTCAGCCACTGACGCTTGATCTTTGCCCTCTGGCGTCTCGGCGTCCTGAGACGTCTCGTCCCGCAGGTATAGCCTCTGAACCTGCAGGTTCT
GCTCCTTGTCGAGTGTCTCAATGTTTTTGACGTACTGCGTGGTCACAACCACCCTGTCCTTACTCGGTATCCCTTGTCTCTTCGCCCACGCCGACAACCA
TGGCAGGCTGGGCACGTTGCGCGAAATTCTTCTTGCGCGAACCCCGGTAGGCCGTGCACGGCGAGCCGAATACGACGATCTCACCCAGCTGCGGCGACTT
GCCCGTCAACACCTTCAACGGCGACGCACGCCCTGGGTTGGAGTTAGTCGGGTGCGGTTCAGAATATACGCACCGTACTCAGAATGTACGCACCGTACTG
GACCGCGTCACCCCAGAACTTCAGCGGGAGCCCACACGCGAAGATCACGCATCACGCCATGTTCATGATGGTGCGGTGCATGCGCTTGGCCTTGCCGTCG
CTCGAGTAGTTCCGCGCTTCGCTGCGCTGTCGGGTCACGCCCGCGTGTTTGCAGAACAAGTCCACGTTCTCGTACTCTCCTCCGGAGTCGGTGCGCAGAA
CGTGGATCTTGCAGTCGAATTCCTTCTCGAAGTAGACGAGAAAGTGCTCGAAGAGCTTCGCCGCGGCGTCCTTGGTACGCGCCAGGAACACGTGGCAGTA
GTTCGACTTATAGTCGATGAAGTTAATCATTTACCCATTCCCGAGGCAGTCCTCGGTCGTCATTGGCCCTTTCAGGATGGAACAGATCACCCCACCCGAT
TGGTGAGTGGGCACCGGTGTCCTTCTTGGACCGCCGGTTCTTTGTCTGCTTGCCTTCGGCGCACGTCAGTCAGTTCACGCGCTTGTGGCCCGTTAGGTGG
ATCCCGGATCTCGGCTCCTTAGCCAGTCGCTCCGCCGAGTCGTAGATCAGGTGCGCCAAGCGCGTGTGGAAGTCCAGTAGCGTGCCCTTCTACACGTCGA
CCGACACTTCCACTGACTGGGTGAGCTCCTGGATTAGCACGGCCATAATCACATCCGACGGCAAGTCATGCCTTCGCCTCACGGCAGCGGGCACGACCAA
CACGTTGCGTCGCATCTCAACGTCGAACGCTACTCGTCCACCGTCCTTGGCCACAACGACGCGTCGCCCGGCTCGGTGGGCCAGCTCAAACCCTCGGTTA
TCGAGTAGCTCATAGGAGATGAGGTTGTGCTCCACGTCCCTCGCAAAATATACATTGGTGAGCTCTACCATCTGCTCCTCACCGCACGCCGTGATACGCA
GCATCACCTTACCACGCTTGGTGATATTCAGCGACTCACCGTTGGGCTGCACGCACCCGTCGCTGCACTCTTCGACGTCCTCGAGGAACGACTCTTCGTT
CACGAGGTTCACTGTCCAGGATTGAGAGACCGTCGTACTCGCCGGACTTCTCACCGACGGCAAGCGCGAGATGCGCCCGCTGCTTGCCGTCCGGGCAGGC
TGCGCGCAGGTGACCCACACGGCCGCACTCGTAACAGCTGCGCGTCTCCAGGCGCTGGTTGTTGCATTCCCTCACCGCGTTAACCGTCTCGCGGCCTAGC
GACTTCTGCTTGGTCGACTCGGTCTCCCAAGACCTTTCGAAGTGCGCGAGCTCCTCGGCGTGCCGCAGATAATCGGTCCTTGATTGGTCCACCTTGGCCA
TCAACACCGTGCGTAGCTCTGTGGAGGCGTACGGAACGATGTTGTTCAGCGCCAGGTACTCGACGCTGGTCCGCCTGGCCTCGGAGACGGCCACGAGGTA
CATGTAGTGCTCGGGCCACGGCCTCTTGGTGTCTTTTGACGCTGTGAACATCTTCATGGCTTGGGCGGGCGTGATATTTGTCTTGAACGCGTCCAGCATC
CGCTCCATCACGTACTGCAACGTGGGCAACTGGTTCCACCACGTGTCCACCTGCTTGTTGTAGTATCTCTCGGTCGTACCCGACAGATAGTGGCCGAGAT
GGTCTACTTTCACGTCCTCCTGTCACGGGAAGCCGCACGCCTACTGCCCGAGCACCACCTGCCGTTTGAATCTTCTGCCCCAGTCCAGGAAGCCGGAGCC
CAGCCCGACGTACAGCTCCACGCCGTCGAACGGACGGATCACCAGCTTCTTCTGGTGGGCGTCCGG