Description :
From Genome Similarity Track
Location :
contig_143:53946- 54972
Transcript NameFunction/comments
g14293.t1hypothetical protein

Sequence
1026 bases(100 bases per row)
TCACCAGACGTAGGTGACTCGTGCTGCACGTACGGCTTCAGTCGCCCAACGTAAAACGTTGGGTGCAAGCGCATGCTGGACGGTATGTCCAGTGTGTACG
CGTTGCCATGCTTCGCCAACACGGTGAATGGCCCAATGAAGCGCGGAGCAAGCTTGCTTGCTCCGAAATCGGAAACTGCATGTTTAGCTAGGTTCTGCGT
AGCTAACAGAACTAATGAACCAACTTTGAATTCATTTGTGTTTCCCCTGCCGGTGTTATCGGCATTCAGCTTCTGTCGATCGACAGAAGCTGCTATTGCA
TCTTGGACAAACCGAATTACGGCTTGTCGACGCTGGACAAAGTCCATTGCATCCGAGCTGAACCCCTGGTTCAGTTCGTGCTCCTTGTTCGCAGCAGGCC
CGGCCTGCGCGTGATGTTCGTTGTCGTTTAAAGTGTCTACGCCCGTCGTAGACACTGTCTTGTCGTCGCCATGACTGCGCGCAGTACGTGCGCGAGTCGT
CACAGCTGATACATTGCTTGTATCAGCGTGCTTATCCGGTTGTTTTGAATTAACCGGATATCCTCCCCCACTTAAGGAAGGAGCTACCGCACCGAGTACG
CTCGGTACGCGTGGGTGCCTCATGGCATTCACGTAGAACGGTGTGTGTCCTGTCGAGACATGCACCGAGTTGTTGATGGCGAACTCCGCCATCGGCAAGC
AGTCGCTCCATTGATGGAACGAGTGCGCGTAGCTCTTCATGGTGTCAACCAGCACGCGGTTGACACGCTCTGTTTGTCCGTCGGTCTGCGGGTGATCCGC
AGTCGACATGGACAACTGCGTCCCAAGAAGTGTAAACACTTCTTGCCAGAATCGCGCTGTAAAGCGCGGATCCCGATCCGACACGATGTCGAGTGGCATA
CCATGGTGTCTAAACACCATGTCGACAAACAGACATGCCGTCTGTTTGGCTGTCACCTCGGCTGGTACTGCAGCAAGATGTACCATCTTGCTGAAGCGGT
CAACAAAGACCACTATACCAGTCCTC