Description :
From Genome Similarity Track
Location :
Scaffold_1043:5394- 7030
Transcript NameFunction/comments
Phyin_T30-4PITG_22047E3 ubiquitin-protein ligase HERC%2C putative

Sequence
1636 bases(100 bases per row)
TCAAATTCGAAGCTGATCTGTCGGACTGATACCCGTCCAGCCTGTCATTTCCGTGTCAGCAAGACGGAAGTCTCCATCCATTTCGACGCAATTGCGCACA
GCATACAAAAGTCGTTCGCGGCAGATTTCGTCGCTGGAATATCGTGGGAGTTGGAGTGCGAAGAAACACGTATGCGACTTCGGCATCTGCGAGTCCATCC
AGCCTCCAGGGGGTCCTGACGATGAGCCGTTCGCGTCTCCATTACCCGAAGACGCAAGCGCTTGGATCTTAAATTTCTGGTGGAACTGTGCTGAGCCCAA
AGGCAAACGAGACCGGGCCCACACAAACCGCAGAAAGGCTCGTTTATCCTCCGCTTCGAGACTTTCCAGCACGCGCCAAAATCTCTGAATAAACTCGTCG
TTCATCGACAAATCTTCGTCGTACTCGGTATTAATCTGCAATAGCTTCACGTCCACTTCCGCAACGCCACACATGCGTTTCTCAAGCTCATTCCACGTCA
GAAGAGCCCAACGCAGACACCGGCATAATGGAGTGCAGTCCCTGCTTTACTATATTCATCACCTCTTGCGTTTCTTGGATCCGTGCTCGAAGCATAGAAT
CTATATATTCTTGCAGATTATTCAAAGTCACCGCAGTATTGGAGCCATCTTCACAGAGATCAACTGAACGTCCATCGGATAATACAGTCGTAAAGACCAA
ATCCATCGCTTCTAGTCGTTCTTCTAGCCCTTCCTGCTTTGAATTTGGACGTTTAAACTCGTCTAAAATACCTTTCAACGTCTTCCATAATGAATACGCG
ACGAAATCGATCTCTTTGAGCGTTGCTAGCGCACTCTCCGGGTTCAAGTCGTCTTCAACCACTAGTTGTTTCCACACTGACATTGCCAGATCGAGACGAA
CGCACACACGCGTGCGTAGACAAATACCGATCATCTGACCGATAAAGAAAAACATTTCACAATAAAGTTGTCGTTTCTCTTCAGCGCTTTCTCCAGATAA
ACACGATACCTTCTTATCATGTATTTGACGCTCGATAAGAGCTCCATTAAGTACGAATTTCTCACGGTTGGCTCCGACGCCATTCCGCCAATTCGGACTA
GGCAGAAGGAAGGGCAAGACACACGCTGATACGGATACATTGGGGTCTACTTTCAACGACGTACTACTGGGTCCTCCATTCGCAGAATGCTCCGAACTTG
TGGACCCATTATCTTCGCTTTCGGGTACGTTAAGCATCTGTAACTCGGCGAAGAATTGCGAAAAGAACTCTCGATATGGACCACCATAGTCATCCACTCC
TTCGCCCTCGAACTTGACTTTAAAGCTTCGTAATTGACCGTCATCCATTGGGTGGGAGTAGACCATACGTAGCGTTTTAATAGGTAAGAAATGGAGTTCT
TCAAACGACTGGCCAAAGAGGGATGAGAGCAAACTGCTGACTGTTCCTTCGTGACATTTTGCTGCTGCTGCCTTCAGCCGGTTCACGTGTAGCTGCGGTA
AATCTTCGGGATAATCGTACTCGTCGTCAGATTTTTTGGGAGAATTAGCGGTTTTTTCCATCAACGGCGTCCAAAGTGTGTTTTTTACACAGACAAAGAG
ACTGCCGCGACATTGTGACACTAGTCGACACGGTAA