Description :
From Genome Similarity Track
Location :
Scaffold_193:5391- 7174
Sequence
1783 bases(100 bases per row)
TCATCTTCACTCTGATTAATTATAATTATTGCATCTGACCTATTGCGTCTGACCGATCTGATTTGCTAATAAAGGGTTTTGTCTCCGACGTCGGAGCTTA
TGAGTTATTTATAAAATATGCGAGTGACTTAGTGTTTGTATAGCGATATCCACCCTGGTTGCTCCGACCTGATACGTCGGAGAGATAGCTGCGAGAGCTT
TACTTGTCAATCTACTCTCTGATTGGCTATAATTATTTTATTTGACCGCTTTGATTCGCTTATAAAGGGTGCCATATCACTACACTCACCCTATTGGTCA
ATACAGTCAATACGTAATTCAAGTGTGGTCGGAGATTTGATGATATTTATCCATAAGAACACAAGCACAAAATCGACTGGACTGGATCAACGTCTCCAGG
AGCTTTTCCATTTTCCGTCTTGCCGCGATCGAGAACGTTGCCAAGAGCGCAATTTTGCCCCACAGCCCAGCATAACAACCTACTCCGTGCACACCATGCT
ACGAACCCTTCCTCACGCATTAGCAACTGATCTATTGGATGTACATCAAAATAAGACGGCGTGATGAGCGCTCTACTTTAGCAATATAATCAACTGCGCG
CCAATAAATAGCATCAACCCTGACTAAAATTCCAATCAGCAGGGCGACACGCAGCAATTGAAGGCCGTACGTTTGGCTGGCTCCTTTCGGTTAAAGAGAT
CATCAGCGACAAGATGATCCGGGCTAAGGCTAAATATTTGCTTTGCGTGAATCCCTCCGATCACACTATAGCGATCTCGTGGTTGTCGCGGTGTAATGTG
TGGCACGACACCAAGACTAATCGATTGCATGTTGAAGCAGGCAGCTTAGACGTGTCGACTGTCGAAGAATAGAGCACGAGCCTGCGAGGCCTGCTGCATG
ACTACAGCCTGTCAGAAACCTTAAACTACGGACGAGACGGAGATGTTCTGTCGTATACAGCCATTCTGGACGCTCTCTACCCGCGCTCTTCTTGGCTGCA
GGAAGTATAAGGGCGGGTCACGGTCGTGCTGTGCATGGACATGGCCCGCACGGAGAAGATCAGCTCGCTCGTGATCAACCCGCACCAGAAACCCCACTGC
AGAATGGCGTCGATAGGACGCAGATAGGCGTGCGATTTTAGTCAAAATCGTGAATGTCATTCAAACTTTTTGTGATTGTTTGGATCGTTCAACCTGAGCA
TGTGTGTCCGCAAGGTTCTTTTCCTAGTCTACAAAGCACCATGCCAAGGCGCGCTCGAGCTGTCGAGCGTACGTCTCTATTTCTTGCCAGCCAACAAAAC
CTCGTACTTGCAACCTAAAGACGCCGAGGTGATCAAAGCTTCAACCTCAGATGTAGGTGCGAGTTTCTGAGTGTTCCCGTGGATCCTCTAGAGCAAGGCA
ATACCGCCAAATAAAATGGACATGCTCACAACAGTTCGTAAGATCGTGGCGGGCGTGGGACGCATTGACGCCAAACGCTATAAGGAACTGCTGACTTCAC
ACAGGAATCATCGACGCGGCAACAGCGGCAACACTCAGACATAAGAACGAGCCAAATTGCATCTTCGTGACTTCTCATCTCGACGATCTGATCCGAAATC
TGTCCTCCGTTACGACACATACATTGCGCATGAAGCAGATATCGAAGGGTGGGTGAAGGACGATGAAATGGAGGTCAAAAGTAGCAGCAGCAGCGACAAG
GACGAGATCAACCACCCTCTGATGTATCGCGAAGAGTCTGCCCTGTGCTAGCAGCTGGGCACTTACACGTTTTCTCACGGCAT