Description :
From Genome Similarity Track
Location :
Scaffold_1778:5390- 6939
Transcript NameFunction/comments
Phypl_g14129hypothetical protein

Sequence
1549 bases(100 bases per row)
GCTGCCGCAGCGGCCTGAGCGGCCTCACTCTTATTTTCTTTCTCGCAACGGACAAGTCGCCCACTCGCCTAATGGCCCAATGCCTTGGGCTGACTGTATA
TTTGTATATCTGCATGTTTGTGCGATATGCGGCCGCCTCTGCCGTTTGTGCGTGGTGTGCTAGCTTGCGTTGAGGTTAACATTGCTGTTCCGCAAGGAGG
TTAAGCTTTGGGTTCGATGCTGTACTCAAATTACATGTTCGCGTACTCTGTGACGAGGTTAACTTTGCTGTTCCATTCNTAAGCTTAGTGTTCAATCGGT
GCTACAAATTCATATCCCTTTCCTTCAGACTCCTGAGCTTGTAATACACCCCGTGTTTGTCCCTGATGCTTATCCTTCCGTGTTGTTGAGCGTGTTGTCC
TCCACAGCCTCGTCCTCAAGAAGGGCATtacggacaagaagacggcgctccttctcgaaggcggcgacgagcttATGGTTCAAGTGGGCCTTCGGCTCCT
TAGTCGGCTCCCAGTCGACGAGGTAGTAAGTCACCCGCTTTTCGCGCTTCCAGTTCNCGATTCTGCGCGTCTTCCGTtcagcgagcgaggcgaTGATGAC
TTGGATCGCTTCGGGGAGAAGGCTTGCGGAGGCGATCGTCGTGTTCATGGTAAGTCGCAGGTGACGGATGGCCTCATTATTCACTCGAatcttgtgcttc
ttgctaGCAGCGATGAACAGAGTCTTGAACGCCTTcgcggagctgacggcgTTCTTGGTAGGCCTGGGCGCGGGCATGATGGCAGCGTTGTGAGCGGTGA
AGTCTCGAAAGCAAAGTGACGAGCGGCAGAACAAGCACCAAGGCAGGTACAGATCGAAATGGATGGCGCGAACGTAACGGAGGTAAAGCATGGGTAATTA
CGCAGCGGATATTAACGCAATGATGTTTGTAGTATGCACAGGTGCAGGGTCACCAATGCGACCGGTGGCTTGAAGCTGCCTGTAGTGTTGGATGCGAGCG
TTGAGATGGCCAGCCTTGTGAAGCTTGCGCATGGACTTGAGGTCGTTTTGAGACCCGCGGGCTATGATCTTGTGCTCGCCAAGAAACAACAGGAGTTTCT
TCTCAGCGGTTCCACCGAGCTCCAGTACATCGTCTCGGTACTGGGGTGACTTCTCGTCAAGCACGAAGCCATCGGAGAGTAACAGCTTCAAGAAAGCCAC
gaccagcttggcgttggaCCTCGTGTGCTTGGTGGCGCCATCGGTTGAGCTCCATATGCGGGGCTCTTGGGCGTACCATGAGAACCAGACGTCCTTCagg
tttgttgctgctgctgcacggcgtcgctttgctggtggctcaTTGCTTGTGTCCTCACCTCTTTCGTTTGTGTCTGGTGTCTGTTGCGACTTGTTGTAGA
CTTTAGCTTCCATCGTAGACAGCCGAGCGTCGAGCTTGTGGTTGATCTGAATTAACTGTTCAATCAAGGCGGCTTGGTGAAGAAACGTTGGGTGCTTGGT
GATATCGCTCGTGCTGTCTTGGGCCTCGGTGTTGTCGGCTTGGGGAGTT