Description :
From Genome Similarity Track
Location :
Scaffold_712:5390- 6870
Transcript NameFunction/comments
Phyag_g7627conserved hypothetical protein
Phyag_g7628hypothetical protein PHYSODRAFT_345188

Sequence
1480 bases(100 bases per row)
CTCACGATTTTGAAGAGCGAGCTATGCTCGCCACTTTCTGAGGATTTGGCGATGCAGCAATTATACCTGTCGAGATTTAACTTATCGCAAGCTGCTTACG
GCTGCTCTAAGACGATTTCTCTCGCACAGCGGACTGAGAGGAAGGCTTTCAGAAAGGAGGTGCAGCTATTCGCGCAGGCGAAGGTTACGTCTGCATCACC
AGTGAACCAGAATCAGGAGGGAGATAGTCGAAAGCGCAAGAAGTAGGCAACGCAATATGTTCGTTAATGGAATTACAAAGCTGACATCGTAATAGTCAAA
ACCAGCTTTCATCCTTTTGCACATCTACTGTGTGTGAAGCGTCTGTTTGCTTCCTACAGCTTCACAGCAGGCTTGGGTTTCTTGTTATCACCTTCCTTGA
TAGCCTTCAGTTGGTCCAACAAGTATGCCAAGTCGAACGCCTTTTCCTTCAGGTAGTGGTAGCGGTCGCTGGCACTGAAGTGACCCGATGACAAGTCCAT
CTTCAAGAGGACCTCATTTTGGTCGCTCTTCATATCACGCAGCTTAGCTACCCACTTGGTGGGCTCCCAGTAGGCCACGCGCGGATCAAACAACCCGCTC
GTGACAAGAATATTTGGGTACGCTTGCTGCTTCACATTCTCGTATGGTGAGTAGCTGAGCATGTACTCGAAGTACGCCTTCTCGTTCGGGTTGCCCCACT
CCTCCCATTCCCCAGTCGTTAACGGGATTGAGGCGTCACTCATGGTGTTCATTACATCCACGAATGGCACACCAGCGATCGCAGCCGTAAACAGGTCAGG
ACGCATGTTCAGCACTGACCCCATAAGCAATCCACCAGCGCTGCGGCCTTCACAGGTCATCTTGTTGGGGCTCGTGTACCCAGCACTGATCAAATGCTCA
GCACAATTGATGAAATCCGTGAAAgtgttgatcttcttcttgtacttTGCGTCCTCGTACCACGTCCGGCCCATTTCACCACCTCCTCGGATATGCGCGA
TTGCGTAGATTACACCTCTGTCTAGAAGAGGCAGAATGGACGAAACGAAGCTCGGGTCGATCGGGACCTCATACGACCCGTAACCATACAGATGCAGCGG
CTGGCGGTCTTGAGAGCGCATGTCCGAGCGGTATACAAGCGAGATAGGCACCATGGTTCCGTCGCTTGCCTTTGCTTCCAAGCGCTCAGTCTTGTAGAGC
GATCGATCGTAGTTCGGGACaggcttctccttcagcagcgtggaTTCGCGTGTGTTGACGTCGTAGTCGAACGTTGTCCAGGGAGTAGTCATCGACGAGT
AAATGAAGCGGTACTTGTCAGTGTCAAAGTCACGGTTGACAGAGCCGGAGACAGTGTAGCTAGCCTCCTTGAACGTGATCTGGCGACGAGCATGCTTGTT
GTCGCCCTCCGGAACAATGACCCAGAGCTGCGAGTAGCCGCCCTGTCGACCCTCCATGACCATAAAGTCCTTGAAGCAGT