Description :
From Genome Similarity Track
Location :
Scaffold_815:539- 2858
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_815-snap-gene-0.6Novel protein
Pytar_ATCC12531maker-par_contig_815-snap-gene-0.5Conserved gene of unknown function
Pytar_ATCC12531maker-par_contig_815-fgenesh-gene-0.1Conserved gene of unknown function

Sequence
2319 bases(100 bases per row)
CCCAAGCTCGACGGCGACTTGCGAACGCACCAGCCCAATAGAATCCGAATCGCCAGCGGGAAAATGCTTCGTCTCGACATCATGGTAGAGCCGCCCCGTT
GAGAGGGAGATCTTGAGCGTGTCGGGTCGAAACGGCATCGTCAGCTCGCCGCCACCAAACACAAACTCCCATCCGCTGGGTGTGACCGACGCCTCTGGTT
GTCGCCGCAGGTCTTCAAACACGAGCGGCCGGTCGGCGCACTTGATAAAGTTCATTTCCTTTCCACATGGAGAGCGATACGGGTACTCGAGAAACGACTC
GTACTGCTCCTGCTCGCTGTCTGGAAGGCGGTTGGGTCGCACCTGGGAGAAGAAGAATCGCAGGAACTTGGCGCTTTTCAGAGACGTCGCAATGTTCTTC
GGCCGCGTATTCTCCAGGAAAAGGCGCCCTTGCAAGTCAATATAGTAGAAGTAGCGGCGGTGCAGATTCTGCTCGTCGTAGAACTCTTCGCTGCAGGCAA
GGGAGAGTGAGAGCTTGGCCATTTATCCAGACTTAGGGTGCCACGATGGAAACCACTCCGTACCTTTTGATATCTTTGAGCTGCTTGAGCTCGAGATATT
TGTCCTCATCGTGTACACTACCGAACGCACGCGCGTCAACACGACCAGCAGCGAGCTGGCGCAGCCTCGGCGCTTCAAGCAGCCGANNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGCCCGGATTTTCATCATTGGAATCTTCTTATTCCCTCACTATTCTGACCTCCACGAGAGTGACTTAGTA
TGTCACTAACGGGTCGGTTCATCTTCAACATGAACTGTTGTTGGCGAAACGACGCAAGCTCTCCAAGCACTCATGGCTCTAGTGTCTGCCTCGGACAGCG
ACTCCGATGAGTGGCCATTCGCATCACAGTCGTCCTCTTCCTCGGGAGGCTCTGACGACGACAACGGGCGATCTACCGACACGTTTGCAGCCGCCGATTC
CTTCGAGAAGCTACACGTTTCTTCCTCGCGACTTCCGCTGCGACAACGGGGTCGCCATGACCGTAAAACAAGCATCGTCGACATCGACGATCGCTCGGTG
CGCGCGTACAATGAGGCTCTGCGGTCTGTGCGAGCGTCGTCCCATCGCGGGAGCATCTCCGTCGCGTCATCCGGAGGAGCGCCGCACCATTTGTCCGACG
ACACGAGACGCCGCCACCGCGAGTCCAAACAGCGCTTGCAATGTGCAGACACCACGCAGAAGCTTCTCTTGCGCGCACACGAACTCGATCAAATCATCGA
TAGTGTGCCGCTCTGGCTCCATGCGAGCGTCGTGCCGCCCCGGTGGCGCGTGCAGATAGTGACCCACCTCACAGCAATCCACGCGCAGACCCAGTTCTGC
CGTGGCCGTGTTCTTGCCGTGTGGCACTTGCTGCTCCCGCCATTTGACCCAGCGAATGCCCGCGAATTCGAACAGCGGCTCGCGCTGTTTGAGCAGACAA
TCTCGTCATTGGAAGCGGCGATCAAGCAGTGCCAGGACTGCGTGGCCGAGGGCGAGCGAATTTCGGCGAGCACGTTCATTCAGATGTGGTACCGCCGCTG
CCTCGCACGACGTGGGTTCTACACCAAGACGTTACACGTCACGTCACGTCGGTCGCGCGGGCTAATCCCCGGCCTGTTTGACACGATTGCTGCGACGTCA
CGGCTCACGATCCACCCAGGGACACCGCACAGAAGTACGCTTGAATACCCCACATCCCCAGCGATGGCCAAGCACGCATTCCGCTCATAATCCCATGGAG
TACAAAACTGGAGACCGATATCGAATGGATACAATTACATTTTCCAGATTAGAGAATGGGTGGCAGTGCTACTGGTCGACGTACTGGTCGACTTGTAGAC
ACACACTATTGGGATACACATCACTTCCCCACGCACCCACCGCCTCCGCTGTGGAAACCGAGTTATCTCTTGATGTCCTTGTTCTCGGGGCGCTCAAACA
TGGGGTCGTAGAGACGCGACTGGTTGATCGGGTTGCGGTCGTAGTTGGCAAACGCAAAGCGGAACTGGCGCCAGCGCGCACCCGTGTCGGCGTCGTGGTG
GAGGTGCTGGAAGCGGCGGTCCTTGTCAAAGTACACGTCCGGGTTGAAGAACAGGTACCGCGTCGCGACCGTGCCAGCGGCGCACGCCGCAATGGACGCG
ATGAACACGATCGGGAACGTGCCCTTGTCGGTCGTCCAGAGCTTGAAGACGTTGATGCCAGAGCGCGTCGCGCGAGCCGCTACCATGGTACCGGGTGCTT
GTCGTTGGGGGAGGTGCTT