Description :
From Genome Similarity Track
Location :
Scaffold_287:539- 2774
Transcript NameFunction/comments
Phyra_85700putative alpha mannosyltransferase

Sequence
2235 bases(100 bases per row)
CGCCATGAACCGACTCGGTACAGTCGGATGCCACGAGAAAGCCTCGTTGAACGCCGTCATGTTGGCCACGGGTGCTTCACGACGCATTCGAGTGTACATC
TCGGGCGAGTCGTCCACGCGCACAACGTACTCGGCGCAATCCTGCAGACTGTCGAATCGGCCACAATCGATGAAGCTCTCGGGGTTAAACAACTCGGACA
CGGTCTTGGAATCGCCCCAGTACACGGGCACACTGCCCGCCAGAAAGGCATTCACCAGCTTCTCCGTCACGTAGCCCGCCGCGCGCGTGTTTTCAAAGGC
GAGCACGAACTTGTACGGCGCATACCGGCGCACCGCGTCGTCATTGTAGAAAATGGCCAAACGGGATGCCATCTTCGTCTGGTCAGGAGGTCTCGACGAC
CCCGCACACTTTCCGAGGGCGTCTACAGGTCGAAGAGCATTCAGTGCGTCGTACATGAGCTCGCGGTCGCTTCGATCGCAGTGAGCGTACAAATATGCGC
AGAACTTCGTCTTTGGAGACTCGGTTTTCGTGTCCGAGGGAGACAAAAGCGACAACGGCCCGTGGTCTAGCCGCTCCGCGAAGGACGCACTTGCCATCGA
CAGGTGGATGTGCTTGGTCCGGTTAGCGTTCGCTAGCGTCGAGATCAGCAGTACGCGTTCGTCGAGACCATCGGTGCTCCAGGCCTCACCTGACAGCATC
ACCAACTGCGTCGTTCTATCTGGTTTTGTTGCACCAGATTTGTTGCGACTGCTGCTATCAACGCTTTTGGCGGTGCCGGCACTGTAGCGCTCGAAGTATT
CTGCCACCATCTTCTGGCACGCGGGTGCTCCTGCTGGATTGCATTTACCACCCAAGGGACTGAAGACAAACACGTCGGGAGAGATACCAAGGTATTTCTC
CAGGAGGTTGGCTGGTATCACTAACATGGGACGCATTTGCGCCTCAAAAACGGAGGCGAAGAGGCATTCCAGCACAACGTGCGAGTATGACGCGCTAGGT
GCATACGCAACGACCAGAGCGGACTTGGCCGGGTCTGCCTGGAAAAGATTATGCCGCCACAGCTCTCCTCGCGATAGGTCGATGGGTCTTTCTTGCTTGA
GTTGGTGGTAGCAGTCTTGGATTTTCGGCTGTACAGTTGTTGCGAAGTCGAAATAGCTGGCGTTTACGACTGTGAACGGCAGGTGCTGCTTTGCCTCGAG
AAAGAGAGACAAAAGGTAGGACGGGAAGGTGTTTACTGATGAGATATATGAAATCTCGACCCCTGCATTGGTTGGAGCTGACAGCGTTGTCGTCACTTGC
AAGTGTCCTGACGAGACGATTCTTGTGTGGACATCAACCTGCAGTTGGTGCAATTCGTGGCTTGGGATAGGAATTGCGGAGGTCATTTCCAGTTGAGAGG
GAGACTTATAGTGATTCCACGTGAGGCGGTCGAAGTCATGGCAAAACGCTTTGCCTCCAAGAAGGTTCGCATGGGTGATACGGACACCGAGTGGGGATAA
CTCTGCAAATGAGATTAAATTGTCTCTGCAGGGCTGGAGAGTAAGATGCGAAAACTGTTGTGTGTTTTCCAGATGAACTTGCATCACTAGTAGCCACAGC
CCGACGCTGACATCCTCCAGTCCATTCAAACTCCGCAGTCGCCAATGATTTCTTGAAAGAAAGCGAGCACAATCCATCGAAATCACGTAGTGAGGACCAA
ATGCATAGGGCAGAAGCTTGTTCATCGGATACTGATGCTTTGGCAAATAGTTCTGGTGCGATTCTTGACGAACAGGGGAAGAAATGCGAGTAAAGCTCGA
GCTCCACGCTTGACCCATATACATCCGTTTCCTTGTCCCTTTTTGCTGAAGGAGTTGAATTAATTTATCCACTCGCAAGTAGATATCATCATCTGCGATC
ATCACGTACGGCGTTTGTGCGAATTCGGCCGCCGCAAGGTGGAAAAAAGCCACCACCTTCTCCGCCAAAAGTCCGTAGGAGTCTTCACACTCAAGCTCAT
CGGTCAGCAGGTCTCCGTACACTTTCTTCTCCATATTGACTGCATCCTGCAAGTATCGCTGCTCACTCTCGTCGTGTACACCGCGCATGTTTGGGTTACA
GCCCAGAAACACCACTTTCGCTCCATATTTCCTCGCGTCCTGTGCCCATGTATCTCGAATCGCTTGGCGACGAGCGAAGTTTGTCACCACGGCCGTCTTT
ATTCCAATCACCAGCACAGGCTCCGTGCCATCGGC