Description :
From Genome Similarity Track
Location :
Scaffold_22:53898- 59207
Sequence
5309 bases(100 bases per row)
AAAAGATGCGATCCGGCAAGTACAAGTATCTCGATCAGTGGGTCGGTAATGAATTTGACTCCTGGGAGCCACAAGATAATCTTAGATTAGTCAATAAGAA
CAAGAGATCAACCTTAGAGAATGAGTACTGGAAGTCGATAAAAAATGAGTCGAACTAGCTTCGAAATAAGTTTAGTAGAGCAATCCTCTGTAAGCGTTGA
CTCATCTATATCTATCAATCTATTTTCCAAAAATAATGCTTAAAAATATATGACTTCATATATAGAATGTGTTGCAACTGCGTAGAGAATCAACGTGAGC
TTGTACAGCTCCGAAGAAAGCTGTGGATAATTCAAGAGGTTAGTCGAATCAAAAATAACTCAGAGATTTAGACCCAGTAGCCAATTTCCGGAAAGCCGTG
TGCAATCTACAGTACCGCGACCAGTTAGAAACGATATTTGGTGTGCCGTTTCATTGCATCAAGGATCGATACATCAATCTCCTCAATGAGCGAAACCGTA
TCTGTCATACGTATCATCCATTTAGGCATGACTCCGTTATGCCAAGCTATTGGTGAGTATGTATTTAATCGATGCTAATATTTTTTTATGACTACCATGA
TATAGTTAGACGATATTTCCCAACTTTACATCCCTCGCTCAACGAGAGCAAAAGCGGCAGGAGCTACTCGAACGAGCTGAGCGCCGAGTTTGTCAAGCCA
AGTCCAAGCGCCTTATGTACGAAGGTGCATCATGGGCTAGCGATATCGCGAATGGTATCACTACTGTTCCAAAGAAATCAACACAATCCGCTCAGTCTGA
TATTTCGGTTGGCCCTGACGAGGCTACGCCGGAAGAGTTAAAAAAAAGTCTGAATATTGAAAACTCCCAAAAAAAACCTGAGCCCTCAACAATGGTAGAT
GCTGAAGTTAATGCAACACCTGAAATGAACGATGCATCGACTACTGCAAAGCCTCAGTCCGTTGATGCTTCCAGTACTGCTAAGCCCAAAACCAGTGATG
GTTGGGTCCACGTGAGCCCCGATATGACTGATGTTGGAGTTGATAATAGTGCAAGAATGACAGATGCTGGTGTTGGCCCTGATAGTCCACTGCCGCAAAA
GCCCGTCGAAGAAGATTTGTTCGACGAAGGCAATGCTGAGATGAAAAATCAAACAAAGTCAAAGGAAGCGGTCGCTAAAATCTTCGAGGTTTACCCAATA
TTCATCCTATTGCTTCCAACGGCCGGCAGCTTACTAAGTATTATATTGGGATGGATGCTAAGGTGTACAGTATTAAACTGAGAAAATATGTACTAGTTCC
GAGCATTGATTGGTCTGAGACGTATGACCATATTGGTGAGGTATTAATTAATGATGTCAGATTCCTCGCATACGTCAATGAGAAGGAGCGACGTAATGAG
ATGGGTAAAGAGGACTAAAATAGCCCATACCAGGTCTGGCAAAATATCGGCTCAAAAAGAAAAAGAATCAATGCCTCAGAAGGAGATTATTCAGACCGCT
CTAAGCAGAGACTTGACGACAGTTTTGTGTTCGATACTGGAACATCCACAAGATCCGATCAAATGGACAGCAAGCTCAAATTATTTTGGACAATTAGCAA
AAATAGGGAAGTCCTTGAATCTAACGGATTGATAAAGAAGATTGTACCAATTCTTAATGGTTCCGCAAAATCTTCTCCTATTGACAAAGATGGCTATGTT
TGGATCAATGGCAATAGCATTAGCGTTTACGGGAAAGATAGCGATCGTGTGAAGCAAGCAATCACTCAGAAAGTGAACTGGATAATGACATTCCAATCTT
TCATTAATATGACTAAAGCCAGGGACCTCGAGTTAGAACTAGTTGGTAGCAATGAAACCAAACACATAAATGATTTTACCCCAGCTAATGGTGAAGCTCA
GCATGGGTTAATGAGTGGTATTGATGAAGACATGGACCCAAGCCTATCAAACGCTGATAACGACGCCAAGAATATCTTAACTTATTACTACAGCCAGTTG
CACGCTAATAGTATTGATATTCCCTTTCGGCTACAACCAATCGTGAAAATCAACGGTGTTGTTAAGTCCCATCCATCATACTACTTTGGGCAGCCATCGG
GGTCTAGACCCCTAAATATTTTAAATCGTGAAAACAAAGCACACAAGCAGGTGAGTGGTGTAGCTTGGAAGGGGCTAATGAAGAATATCATGTGGATGGA
TACCTTTTCGTCCCTACTCAACGGGGTTGAGGACTTGGACCGCTATCTTAATGAGGTTGAATACCCCTTCCCATCGAGCGATGAAGAAGAAGCTAAGATA
CTTGAAGAAAAGGAGCTTGATAAGAAAAGACGTAAAAACCTGGATGCTAATCTTGAAATATTGAATGAGGCTATTCTAAAGTCTGTACACGATATTAGAC
AGCAAAGCGTTGAAGAGTATGAATACGATTGTTGCTTGCAAAAGCTTCATGATGAGTCAGAAGCAGCTTTTCAGACATACGGTGAGGCTCAGAAACGCTA
TGAAGAAGCAAAAGAGGCTGTTAGAGGGAATAACTCAAAAGCAGCGAGATCGGTGTTGAAGGCAGCTACATCAGCTATGAAGGCGACAAAATCGATATAT
CAAACGAAGGCTAAGCGATACGCCGAGGCAAGCGAGGTATCCGGCAGTGGCGTTAAACGAAAGCTTCAAGGTCGAGGATTGCGCGGTGCAGGTGTTGCCC
CGCTGGAAGGTGTAGTTCGCCGAGGCCGTACCTACAATCGCAATGAGATCCAAGGATTAGCAACGCCGTCAGCCTACACATACAAGCAGATCGGAAGCAA
GTATATTCGTATCCCCGACCTTGATGCTAAAAAGCTCGTGATCGTTCAGCCGAATCGGCGTAAATGTGGTCCTAAGTGGGAAATCAGTGATAGCCTCCAA
GCCATGATCAAGGCACTTGTCTATAAGAACCGTATCGATCAATCCGCTTACGATAAACTCAGCGTTGAAGATAAGAAACTGTTCAAGGAGGTTTTATTGA
TTACTCATCTCCAATACAGCTTCCACGATAAGTTAGAGGATCCTCTAGATACCCTTAGGGCTGAATACAATAAGCTAAAAGGAGAGCTACAACTTGGAAA
TGACAACCCCAGTATCATCAAGCAGCTCAAGTCTCCCACGGTGGATATGTACAGCAATCGACTGATTGATGATAAAGAGTTCAAATATATTATCACCCGT
TTATTATAAAACCATGTTCTTCTTCAACTCGCGCATTATATCCAGTTCCGGAGGCAGCTATGGTGACAATAGCGACCTCAACGTCGCTGAGTTGAAAGCT
ATCATGAAGAACCTCATCATTCATGATCGTCCCCAGAAGACCCAAGCCGCTGTGTGGGCTACTGACCTCGACAAGTCGACCAAGAATGTGGAGGCATCTA
CCCAAACTGAAGGCGGCCGAGTCTGGGCTTACCAGCCAAAAAAAAAGTCAAAGTCTGTGAAGACATTTGCTCTATAGAGCAGAGCGGATATACTTAGATG
TCTACGTCTGTTTTCTTCTCGCGATAGAATCTGATTTTTTTATCTCCGATATCGATAGCCATGACAGCATTCTTGCCACTATGTACGTTGTACATTGGGA
TATAAGCATTATTCCATATCGAAACCACTCCAGCGTGCATCGTTATTAAACCGATGACTTGGCCAATTTCAGGGTTAGTCAGATTCTTTTTGATCATTTT
ACTTGGTCCGCAGCCCATGATACTCTATTACAACGAAGTACTCAAGATCTGCTCTATATTTATCGGTGCGAAATTATCCCTGAGCCAATACCATATATAA
CCCTCTCGTGGAATTCGACAATTCGATCACATTGTAGTTGATCAGTATCAACGACATTAGCGTTAGTAGTCTGAGGGCAAGCGGTCTTCGCCACGACCTG
GGTTTGACAGATACCATTCTATATTTACTCAGACATAATCGCTCTCAACTCATTGAGTTCAGCTTTGAGATTATTGATTTGACCTTGCTGTTCTTGGATA
GATTTACACAGTACCGAGGTTAAACGGGCGAGATCGATTCCCCATGGATTCACTGGAAACCCATCCGGATTAAGCTCATCGTTTGCTCCGATATCTACTG
CTTCTGGTATGACCTTATACAGCTCCTGCGCGGTATAGCCAACATGGACAGTCTGCTCTTGAACCATCCTGAATTTTCTAGGTCTCATTCTCATAAGGCT
TGCCAAACCATAGGGACAGTCTACAATGTCCGCCTTCAACCTCTCATCGCTTGCATTGGTATAGCTTCCTCCACGCACCGGGACATAGGCTGTCCACGCG
TAATTAGCATCGCATTTTCCCAACCTGATAGCTCCTATGGTTGAATCAGTACCAATCGCTGGATAGTCTGTCTGAGACCAATTGAATCGATACCTAGCAA
ATCCATCGCCACCTCCCTTTACGTGCATGAAATTATTCGCCCATACCTCTCCGCCTGAGTGAATGATTGCTTCTGGCGACCACGTACTCATACCAACTCC
CAGTCTTCCTGAGCTGTTTAGATAAGCTTGAGTTGTGTTTCCAACCATGAACCTTAGCGGGTCGCTCGTAGTGGTGCCTAGAGCTACACCACTACTTCCT
CCCGCGACATCGTTGTATACCTGAATTTCAAATTTGATTGGAGTAGTAGCATCGTTGGCTATACGCATTGCGCGTTGCCAAGACCCGCTTAGTAAATTCG
CGCTCGAAACTATATCTATTTTTGCAGTACTGGTAGCTGATCCAAAGCGAATGTATCCTGCTTGAGTGATTCTCATACGTTGAGTCATTGGTGATAATGC
ATTAGCTCCTGACCGTTTACTGATTGCAAAATCAGCCATTGAATATTGAAGACTCGTAGCGGTTCTAGTACAATATAGATTAACGCTAGGGGTGTACGTT
GTCATATCACTAGTACCTTCAATCGTGAACGATAATCCGGCCTGAGCGCCAACCGTATTGCTTTGATTATGAATCATGAGATTAAAATCAGAGGCACGCG
TTGTTGATGTAAATGATGTCCCGGCCGCAATCTGACATTGGGTAGAAGTAGTGGATATCAGATTGGTTGACGTTAGAGATGAGATACCTGATGAGATGCT
ACTATTAGAGTCTAGTACAAGAGCCTTTGATGCTTCTGCAGTTCCTGCTCCGGTGGTAAGATCTAGATAGTTCAGCTCAACGGTAGATGCTGTGCATCCA
GCAAGCTTGTTCAGCTCCGCACCTGTAGCATTGAGAGTATCTTCCCTGAGTTGAAGCGTAGTAGGATTGATATTCAAGATCGTTGCATTCATAGTTTGAG
TACCTGACT