Description :
From Genome Similarity Track
Location :
contig_24:538965- 541127
Transcript NameFunction/comments
g4624.t1hypothetical protein
g4625.t1hypothetical protein

Sequence
2162 bases(100 bases per row)
CTCGTGGCCTCAGCCACTGACGCTTGATCTTTGCCCTCTGGCGTCTCGGCGTCCTGAGACGTCTCGTCCCGCAGGTATAGCCTCTGAACCTGCAGGTTCT
GCTCCTTGTCGAGTGTCTCAATGTTTTTGACGTACTGCGTGGTCACAACCACCCTGTCCTTACTCGGTATCCCTTGTCTCTTCGCCCACGCCGACAACCA
TGGCAGGCTGGGCACGTTGCGCGAAATTCTTCTTGCGCGAACCCCGGTAGGCCGTGCACGGCGAGCCGAATACGACGATCTCACCCAGCTGCGGCGACTT
GCCCGTCAACACCTTCAACGGCGACGCACGCCCTGGGTTGGAGTTAGTCGGGTGCGGTTCAGAATATACGCACCGTACTCAGAATGTACGCACCGTACTG
GACCGCGTCACCCCAGAACTTCAGCGGGAGCCCACACGCGAAGATCACGCATCACGCCATGTTCATGATGGTGCGGTGCATGCGCTTGGCCTTGCCGTCG
CTCGAGTAGTTCCGCGCTTCGCTGCGCTGTCGGGTCACGCCCGCGTGTTTGCAGAACAAGTCCACGTTCTCGTACTCTCCTCCGGAGTCGGTGCGCAGAA
CGTGGATCTTGCAGTCGAATTCCTTCTCGAAGTAGACGAGAAAGTGCTCGAAGAGCTTCGCCGCGGCGTCCTTGGTACGCGCCAGGAACACGTGGCAGTA
GTTCGACTTATAGTCGATGAAGTTAATCATTTACCCATTCCGAGGCAGTCCTCGGTCGTCATTGGCCCTTTCAGGATGGAACAGATCACCCCACCCGATT
GGTGAGTGGGCACCGGTGTCCTTCTTGGACCGCCGGTTCTTTGTCTGCTTGCCTTCGGCGCACGTCAGTCAGTTCACGCGCTTGTGGCCCGTTAGGTGGA
TCCCGGATCTCGGCTCCTTAGCCAGTCGCTCCGCCGAGTCGTAGATCAGGTGCGCCAAGCGCGTGTGGAAGTCCAGTAGCGTGCCCTTCTACACGTCGAC
CGACACTTCCACTGACTGGGTGAGCTCCTGGATTAGCACGGCCATAATCACATCCGACGGCAAGTCATGCCTTCGCCTCACGGCAGCGGGCACGACCAAC
ACGTTGCGTCGCATCTCAACGTCGAACGCTACTCGTCCACCGTCCTTGGCCACAACGACGCGTCGCCCGGCTCGGTGGGCCAGCTCAAACCCTCGGTTAT
CGAGTAGCTCATAGGAGATGAGGTTGTGCTCCACGTCCCTCGCAAAATATACATTGGTGAGCTCTACCATCTGCTCCTCACCGCACGCCGTGATACGCAG
CATCACCTTACCACGCTTGGTGATATTCAGCGACTCACCGTTGGGCTGCACGCACCCGTCGCTGCACTCTTCGACGTCCTCGAGGAACGACTCTTCGTTC
ACGAGGTTCACTGTCCAGGATTGAGAGACCGTCGTACTCGCCGGACTTCTCACCGACGGCAAGCGCGAGATGCGCCCGCTGCTTGCCGTCCGGGCAGGCT
GCGCGCAGGTGACCCACACGGCCGCACTCGTAACAGCTGCGCGTCTCCAGGCGCTGGTTGTTGCATTCCCTCACCGCGTTAACCGTCTCGCGGCCTAGCG
ACTTCTGCTTGGTCGACTCGGTCTCCCAAGACCTTTCGAAGTGCGCGAGCTCCTCGGCGTGCCGCAGATAATCGGTCCTTGATTGGTCCACCTTGGCCAT
CAACACCGTGCGTAGCTCTGTGGAGGCGTACGGAACGATGTTGTTCAGCGCCAGGTACTCGACGCTGGTCCGCCTGGCCTCGGAGACGGCCACGAGGTAC
ATGTAGTGCTCGGGCCACGGCCTCTTGGTGTCTTTTGACGCTGTGAACATCTTCATGGCTTGGGCGGGCGTGATATTTGTCTTGAACGCGTCCAGCATCC
GCTCCATCACGTACTGCAACGTGGGCAACTGGTTCCACCACGTGTCCACCTGCTTGTTGTAGTATCTCTCGGTCGTACCCGACAGATAGTGGCCGAGATG
GTCTACTTTCACGTCCTCCTGTCACGGGAAGCCGCACGCCTACTGCCCGAGCACCACCTGCCGTTTGAATCTTCTGCCCCAGTCCAGGAAGCCGGAGCCC
AGCCCGACGTACAGCCCACGCCGTCGAACGGACGATCACCAGCTCTTCTGGTGGGCGTCCGG