Description :
From Genome Similarity Track
Location :
Scaffold_220:5388- 6937
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_220-fgenesh-gene-0.1Nucleoredoxin
Pytve_DAOMBR484maker-pve_contig_220-fgenesh-gene-0.2Nucleoredoxin

Sequence
1549 bases(100 bases per row)
GCCAATCGTCAGCATACGGATCTGATTTTGTCCAATGGAATAGCAAGCTTCAATGTTTGGATCTCCCCATTTCGTCCAATCGCCCGCTCTGCATGTTGAT
TTGCGGCGATCGAGGGCAGCCATGCAAGCCTCCGGATGGGAGGGTGCGGAAGGACGCACCTCGCCTGAGCATCCGAAGCTTCCAGCAGAGAGGCGACGCG
TCTGTGCGGCGCGAAGCTGCGAGCTGCAGACGATCGATCACTTTCGAATCCACCGCCAAGCCGCGAGACCTCGAACACCAAGCCGAACCTTTCGAAGATG
GAGGCGCTGATCGGCACGGAGCTTCAGACCAAGTCGGGCGAGATCGTGGCCACGTCGCAGGCGCTGGCCGGCAAGAAGATCATCGGCCTGTACTACAGCG
GCCACTACTGTCCGCCGTGCCGCAAGCTGACCCCGCGGTTCGCCAACCTGTACGACGCCATCAAGGAGGGCAACGACGACGTGGAGATCGTGTTTGTCTC
GTCCGACAAGGAGGTCGCCAAGTTCGACGAGTACTACGAGGAGATGCCGTGGCTGGCGCTCCCGTACGCCAAGCGCGAGCTGTACCTCGAGCTCCGCGAG
AAGTTCGGCGTCAAGTACGTGCCGACCATCATCTTCTTCAACGACAAGGGCGAGATCATCGAGCGCGAGGGCCGCGAGTTCATCGAGGAGCACGTCGACG
ACGTTGACGCCGTGCTGGGCCACCTGCGCCAGAAGCTGTAGAGCGCTTTCAGCTCGGCAGTTGCACTCATCCGCGCGAGGTGTCCTTCCTACGTGTACAA
TCCTAATTTGAACGACAAGAATACAAGCGTCAATGTGTCGTGCTCGATATCAGCTCCTCAATCTATCGTTCATGCTGGTTGCTTGGAGTGTGCAGGCGTG
CCGGTGCTGGGTCACTGTGCGATAGGTGGTCGCATGTGAAGACGGTTTTCGAGCCTCGTCCGCTGGCGGCGGAAGAGGGTTACGTGGTCAGTCGCCTCAA
GGGATTTTTGCCTCCCCATCTGAGTCAAACCGGACGATTGCCAATCGCGCTTGACGACGTGTGCTTTCTGCTTCAGGTCCTCTTCCTCATTCCTCATGTG
GGCCACGCAAGCCTGATGACGGCATCATGAAGAGAGCGGCCATTATTCGCCAATCTTCAGCCAGGAACCATCCAGGTCATTGCTCAGATGTGACAGTTCA
GTGGGTCAAAAATGCAGCATTTTCAAACATTTCCACCAATCCGGGTACGCACCCGCCCACGTTTTCGCGCCACCAAGTTTGATTCGCGCCATATTTTTCC
CTCCTCCCAGGTCATCTCTTCCTCGACGAGAGTGGTCGCCACTTCCGCTTTCGACGTCAAGTGCAGACCAGTCGACCTTTACCTTTCACCCGCACCAGCA
ATGGAGGCCCTCATCGAGAACGAACTGCTGACCAAGAGCGGCGAGGTCGTGCCGACGTCGCAGGCGCTCGAGGGCAAGAAGGTCATCGGCCTCTACTTCA
GCGGCCACTACTGTCCGCCGTGCCGCAAGTTCACGCCGCTGCTCGACAT