Description :
From Genome Similarity Track
Location :
Scaffold_159:5388- 6655
Sequence
1267 bases(100 bases per row)
TCGAAGATATCCTCTGCGTCGAACACACCAGCTACGATGCCTGACTCCGTAAGCAAACGTAATAGATCTTTGACTGCCACCAACTTGTTCGCCGTTTTCG
TTGGTGCTCTCACCGGTTCCCTTGGATCTTCGATCTGTCGTGGATTCAGGATCTGCATGACAGGATCTTGATGCAGGAAGTCGCGTAAAGCTTGGTGACG
ATACACAAACTCGAGATCCTTGTCGGACCAGCTTGACCTGGATCCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTC
GTCTTCGTCTTCTTTCTCGTTTCTTCGACTAGCGGGGTTGGGTTTAGGTCCAGTGTTGGCTTAACCGGTGAATCTGCAAATGCATACCGTTTCGCCTTCA
CTTTTCCTTGTTTTGTTAGCGGATCTTGACTTGCGTCAAGATCCGCAGGGGTCCCCGAGGGGACCTGGGGAGGATAGAGAGGTTTCTCTTCTAGATCCGG
ATCCGGATCCACCTCTCTTCCGTCGACAGAGTTCCTCCCAAAACTCCATCGATCCGCGGATCTTGTTTCATTCAGCGGCGTCTTCGTCGATCCGACCTCC
GACGACGCCTCTTCCCGTGGCTCAATCTTCACTTGAGCATCTTCTTGGGACTCACGGTGAAATCCCGAGTCACCAAAAGATCCGGGCACGCGCACGATTG
TGGTGTAGCGGGATCAGCAAAATCTGCGAGATTGCCAGATCCAACTTACCAACTGCGCCCAGACATCGACTAACGGAGGGGGTCCCCCGATGATCCGTGT
TCTGCTGAACTTTCCTCACCTTGTGTACCCGTCGGTAGGGCGGGGTCTGCTCTCTCGGTAACTTTCGAAGAGTTGAAGTGGTGAAGCTTGAGTGTCTTGG
CGAGACGTGGGGATGGGGTGGAGCAGCAGTGGAAAATCTTCACTCTGCGTCCGTGGATGGTTCCGTATCCTAAGCGAATATTCGAGCTTATGGATCCGGG
GCCTAGATCGTGGATCTGGCCGTAGGGTTGCCTTGCGGGTGTGTTCCCTTGCCTTTGTAGTTCCTTTGCGTCGTACTTGCCGCCTCCTGTGACGGGATCT
TGAGAGTTGGGAGCCTCTAGGGTATAACCGACCAAGTAGTAAATTCGGTTAACCTGTCGGATCTGCACGTGTATAGGAAAAGCTCACTAGGTTGTAGGAT
CTGGCCAATGTATTATCCAGTTATCGCTACCAACACTAGATTCGCAATTCCCAACCTTCTTCGAGCT