Description :
From Genome Similarity Track
Location :
Scaffold_30:53867- 55657
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_30-snap-gene-0.35Brix domain-containing protein 2

Sequence
1790 bases(100 bases per row)
TAGGAATTGTATTGGATCAGAAAAATTGGGTGTGAAAAAGGGCGGTTAGGGGCGAAATCGAGTCGCAGGCTCGATTTTCGCGGGTTTGCGATAGCTCTGT
TATTTTGTATGCAATGGCGGTCATTTGGTGCAAAGAAAGTGCGCTTAGCTGTAAGTTTTAGGTAATATAGAAAGGTAATTGAGGTACTTTAAGAAGGATT
TGTGGTTGGGATAGGGTTTTGAAAAGAGACTTTGCCAATTTTTATAAAACAATAATTTTCCAAAATATGGGAAAAAACAGAGAAATAGAAAACGGTGCCA
CCCAAGTGACCAAGCTAATAGCCCATTCACCCTGCTCTATACATTGGGTTTATGGGTGACGATACCGTTTGAGAGAACTTCCATCCAACCATCCATTCCA
TCTGCGAAGAGCTGCGTGCCAATTGGCTTGCTCACAGTCGGTTGCCAGGAGGGAGCAGATCGATCAGCAGACCAAGCAAGCAAGCAAAACAGGCTAGCAA
ACCAGACAAGCATGTCGGTGGCGAAGCGAAGACGTGAGGCCGACGCCATGAAGGACATCATGAAGTCGGCGGACGAGCCGGAGAAGAAGCAGAAGGTGGC
GATCGCCGGCGGCAGCGGCTTCATCAACCNNNNNNNNNNNNNNNNNNNNNNNGTGCTCGTGTTCTCGTCGCGCGGCATCACGACCCGCTACCGCCACCTG
CTGGACGACTTCCGCAAGCTGCTGCCGCACCACAAGCGCGACGTCAAGCTCGACGCCAAGGACACGCTGCACGTCGTGAACGAGATCGCTGAGATCAAGG
GCTGCAACACCACGATCTTCCTCGAGGCGCGCAAGCGCCAGGACTTGTACATGTGGGTGAGCCGCGTCGGAACTGGCCCATCGGTCAAGTTCCTCGTGCA
GAACGGTGCGTTGCTAATCGTTTTTCCTTCATTGATTGATGCTGCTCTCATGATATGACGCGTCGTACTGATGCTTTATTTCTCTCTTTGCTGCATATAT
AGTGCACACGATGGACGAGCTGAAGATGACCGGCAACGCGCTGATCGGCTCGCGCCCGCTGCTGACGTTCGACAAGGAATTCGACACGCTGCCGCACTTG
CAGGTGGTGAAGAAGCTGTTCACGCAGGTGTGGGGGACACCGAAGGGCCACCCGAAGAGCAAGCCGTTCATCGACCGCGTCATGAGCTTCTACTACGCGG
ACGGCAAGGTCTGGTGCCGCAACTTCCAACTGGCAGACGAGGCCGATACGAAGAAGATCGAGCAGGCGGCGCTCCACCGTGGCGAGGACCTCGTGCAGCT
CATCGAGATTGGACCGCGCTTCGTGATCACGCCGATCAGAATATTCGACGGCAGCTTTGGCGGCCAGACGCTCTACCAGAACCCGCGCTACGTGTCGCCC
AACGAGGTGCATTATGCTATTTCCACTCCACTTGTTGCGAAATAAATGAGTCGCTCACGCGAGGTTGCTTTTGCTTTGTGTTTTTGAACAGACCCGACGA
GATGCCAAGATGGACAAGCGCGACCGCTACGTGTCGCGCAAGACCGCGGAGGCCGGCCGCACGGCGCGCAAGCCGGAGCGCGTGCACCCAGAGGACAAGT
TCGCGGATGTGTTTGCCGGCGCGGGCAACTAAGTTACAGGCTGAATTGGCATGTGGTACTCGGCTGGCTCTTGTCCTTGTGTGTAAGCTGTTCATGCAGC
TAGCTACGTTGGCAGGCTTCAAGCAAGTTTGCAAGAGAGAGAAAAAAAGAGAGGCTAGCGTTGGAGACGCAAGCAGATCTCCGCGGTCGA