Description :
From Genome Similarity Track
Location :
Scaffold_6:538512- 540287
Sequence
1775 bases(100 bases per row)
ACACTTCCACCTTGCACTTGATCCGAATACGTCCATGCCATCGATGAGCTAATTTCTTCGTCACGTCTGGTTTGACGCGTTCCATGTACAACCACGCCCT
GCTCCCAATCTCAAAAAGAGATCTCGGTGGGGCTCCCACAGGGTGATTTGTCTCTTCTGAAGCTTTTGGAGGGTCCACCGAGTGTTCGCGTCCACTTGGT
TGAGGTACCGCGGCTTTTTCCAGTCGATTCAGGGCATCATTATGTTGGTTTGCCCGTCGCTCCTTCTCTACATCCTGATAATCTTCGGCCATAGCGAGGT
CAATCTCGTGTTGTCGATTGGTTTTGCTTCGCCACGTCAGTGTGTCAGGCGGCTTGCCGAGTCCTCGTTTGAGTGATGACGACATCGCCCGCAACGTCAA
CTGCTCACCCCAACCGTGAACGAGGTAAAACGGTGTTTCCTTCCTCGAAGTGTTCTGAGATGTATTAATAGCAAATACCAGCTTCTTGGCGATTACGTCC
CAATCCTGCTGCAGAGGACTTTCAGCGTACACTCGTACGGAGGCCATCACCGACTTCACCGACCGTTTCTGCTGTCCATTAGCCTGTGGCTGATAGCTCA
AAGTCGTTTGTGACCTTGACCGTATCATCTCAGCAATGCTTGGAACACCTCGCTCATGAAGCGTGGGTCTCGGTCGTGTCTGATCAATGATGGGGCTCCG
ATTTGTAACGCTGAAGAACCACGAGCACATCCTGATTGCTAGTGGTGACGCACTGCTATCACTAACCTATGGCGAGATATTGACATCAGGGGCATGCCCC
AATTAAACAGCGTGCCCGACGCGTACCGATACGATTTCTCGGCAAACTGTACGAGCTGTTAAGGGCTTTGTTGACATCAAGATTGATAATATTTTCAGAC
AGTCCACGAGCATCACCAATCGTGATTGTGATGAAAAAGAACGGGCTGGATATCCGGCTCTGCATTGATTACAAGATGGGGAATGCCATCACCGCAATCA
TGGAGTACTCAATGCCACTAGTCGACGATCTGTTGACCAATCTCGAGTGATACCTATGGTTGTGCTTGCTAGATGCTGCTAGCGGCTTCTGGGCGGCCAT
GATGACCTTGCGAGCACGTAACGTGTCGGTGGTTGTTTGCGCACTCGGACACTTCGAGTGGTTACGGATGCCCTTCGGGTTAAAGAACGCGCCGATAATC
TACCATCGCATGATTGACAACACGCTCTGGGGGTTTGCTCAGCCAAAAGGAGGTTGGTTAAAATACTCGGAGATGATGGGTTTAGCTGAAGAACAGGCCA
AGGAACGTCGTGGTCCAAGCACCGAGGGTTCGTTTCAAACGAAGCTCGCGGTAGACCGCGAAACACCTGTGGAGGCCGACCCTGTACTACAACTCGTCAA
CAGTCCCGTCGCTGACATGTTTACGAACGGGGAACCAGACAAAGCATCGCTGGTACCTGTGCTTGGTCGACAATCATTTGTGGATGGCATTTGCTTTGGT
AGCGAGGATTTCGACATCTGTCTGGCGACGCTGGATCGATTGCTGGCAAGATTTGCACAGTGTCGGGTCAGCATTAGCTTCACCAAGAGCATCTTCTGTC
AACCCAAAGTGGACTTTCTGTCGCATAAAATTTCGCCAGAAGGTATCAGGGCTGATCCAAAGAAGCTTGAGGCCATCACCGAGCTTTCGTTTCCAACGAG
TAAGAAGGGCATGCAGTCGTTTCTTGGAGCGGTTAATTACTACAGCCGCTTTATTCGAGACGTTGCTGTCTACGG