Description :
From Genome Similarity Track
Location :
Scaffold_85:5385- 6985
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_85-snap-gene-0.18Alpha-amylase

Sequence
1600 bases(100 bases per row)
CGCATCGAACGCTGTTCGAGTGAATGCATTGCGTTCTCTCTCTACAGTCCATTTTGCGAATGCGTCTCCGCACGCCTTCCAAAACAACCGTTCGCGCGTA
TCTCGGCCATTGCACTTCCACTGCCAGAGTCGGCTGTCGTCGCTTTTCGTCCTGCACCTCCACGAACCGCGTCGCTACTTTCACTCTCACCACAAGACGG
CGGCCAAACCAGGCCGCTACCGTTCGTCGTCCAGCCCGCGCCGCGCCGCACTCGCGGCCCACCACTTGTACCGCTCTTCATCTACACCAGGCCGCGCTGC
CAGACACTGCCTGGGCAAGATGAAGGGATGTTCCACGTGCCGGATGAACACGATCTGCCGCTAAAGGAATCGCCACTCAGCCGTCGCGAAATGGACGATA
CTTTCGGGAGTCAGTCACCGCAGACAAACTACGAGCTGGTCAGTATCAAGACCTCGTGATTAAGAGCGACTGAAAAAGTAAGTGGCAGCACATACGTATT
AGCTGTCATTAGCTGGACTCATATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCCGAGACTGAGCCGAGACCGAT
CCAGCTGCGCATCGCGTTTACGATCGACAGGTCGCGGTGCACGCGCGTGTACTTGCCGCCAGCAAAACCCTCCACGGTGTACCCGCACGAGCCGGCACGG
AAAGCCTTCTCGTATGGCACGCTCTTGTCGCAGATCTGGCCAGTCGAAGTATCGAAGCCCTTGGTGCAGTCGGAGAGACCATCCGGGAATCCAGCGGCGC
TGTTCGGGAACCACGTGTACGAACTCAGCACCACGCGAATCTTCCAGTCCGCATCAGTGCGAGTGAAGAGCTGCACCTCGAAGCCTCGGTGCGCGTTCAC
GTCCTTGGCCTTGATGAGAATCGAGCCCTTGTCGCCCATGTCGCGCGAGGTCGAGTCCGGGTTCTGCTGGTCATGGTCGTCGTTCTGGATCACGAAGCGC
GAAGCAGGCAGGATCCACGAGCCGCAGATCGGCATCTCCTTCGGGTAGTCCGAGGACCAGATCTTGAGCTTGGCGATGTCGGTGGCTGAGATACCGGCCG
CCGCGTACTTAGTGTCGAGTCCCTTGTAGAAGTTGTAGCCCGAGTCCGCATTGCAGGCAAGAAGCTGTGCCTCACCACCCATGATGATCTCACCCCACGA
GATGAAATCCGACGGAAGACTGCCGCCCATGTAGTTCTTGAAGATGCCGAAGATCGCCGCAGTGTCCGTTGGTCCAATGTGTTTCATCGCGTCGATGCGG
AAGCCGCTGAAACCGATGCCCATCAGGTCCACGAAGTACTGCGCGATGCGCTCGCGAACGTAAGCCTTGCCAGTGTTCAAGTCTGTCAGACCCACGAGCC