Description :
From Genome Similarity Track
Location :
Scaffold_32:538359- 539416
Sequence
1057 bases(100 bases per row)
GGGTCCCGTGCATACTGTAGGAGGCTCCTTAGGAGCAGTCGTGATCCCTAAAAACTCACGTTTCGTCACAACCTGGAAATTGTCTTTTAGAATCCCGCAG
CACTGCCTTCTGCCGTCACTTGCCCCCGGTCGTGAACAACTCGGTTGAGCTACATCTGTAGAGTGATTATACCGATTTCCCCACTAGGTAACTTTAAAGG
CTCCGATATGTTGGCGATGTTTGTCCGCAGAGCGTACGTGACCGCTTCCATTGCTTTCGGTCATCCAATGGGCCCTCTTAATGCATGCAGATCAGTGGTC
TGCCAATGTAGTCATTGGTGTCTCGCACACCAGCGTGAAACCTCTCGTCATTGCCACTTGAGTGTAGCTCCGTTGCCCCCCCCCTCCTCGCTAAGATAAG
ACGTGCTAGTCTTAACAAGTCAATAAAACAAAATGACAATTCTCTGGAAACTCGAGGTCATTGCAGAGTGAGCTCGCCAACGAAGACGCCAGCAAACGTG
GCTGAATTCGCATGAGCTACAATGTCCGTGTCCACCTGAGTAGACACGCCCGCGACCGAAGAGAAGAGAGAAGAAATATTAACACTCTTTAATAAAAGTT
GCTTAAAACTACGTCGGGAGCTCAGTAAAATTCGTTCTTCAAACAGCGCAATAAAAATAATGTTCTAAAAGTATTTTTTAAAGAATTGTAAAGTTATTTA
TTTAGTTTTGAAGTACTTAAGTATTATTCTTTTCGAGCAGTTGCTTATGCAGGATACGCCGAGCTGAGCCGTCACGAGCAACTGGATATGCCTTGAGCTC
TTCTTTCCAATCACAGTTGACATTGTAGGGTAGCGCACCTCGTTTCGTTTTTTTTGGGTACGACGTTTTCTGATGAAGATGTCAGACTAAAATGATAGTG
TTGAGGTTCATCTCGCGGTCATTTTCATCGTTCCTTTCATCATTTTTTCAAAGTGATTGACATCACAGTAATACCTCCCCACAATTGTCCAGCTCCGTTA
CAATATTGACTTTTGAGCAACTTGGTTTCATCGTTGAGCACTTTGCGCTTCAAGCCT