Description :
From Genome Similarity Track
Location :
Scaffold_12:538340- 560790
Transcript NameFunction/comments
Phyra_75416Eukaryotic/viral aspartic protease, active site

Sequence
22450 bases(100 bases per row)
AGTGGAAACAGGTCAAGTCATCTGAGTAAAGATGCCCCTGCGTAAATACTATAATAGTACACTGTACCGTGAAGTTTACGCATTCATTGCACAGCCTGCA
GGCCAGATCTCCATATTGACAGCCGGCGTGGATTCAGGTTAGCATGCAGTGTACACACTATCTATACACGGTGCAGCTCTGCAGGGCCAGGCAATTCACT
GCACCTTGGAGACTATCCCGGTCTAGTGGTTTGCATTATTAAATATAATACTACCGGTACGTGCACGTGTATTGCTTTTAACTAATATGGCCAGTTCAGC
TTGCCAATTTGGACGAGGACGCTGCTGTCGCGACGTAAGAGCTGCTTTGGACTTTGCAAATTGCGTACGTGTACCGATTTTTGCAGCGTGTTTGCAGCGT
GATACATCCATGGATACAACCATGTTTTTTGTCCAGAATGGCTGGAGCGAACTCAAAAAGAAGGTGATTAGGCTCTTTATTATCAACAAGAATCGTCAAT
CTGTACGAAATACCAAAGTGCGAACAAACGAATGCCGTGCTTTGCCCGAGAAGCTCTGGGTATTTATGAGCAGAGTGAATGCTGCATACATGTATTGTGA
TTTACAGATATTTTGGCACTTTCGTCTCTAATTCGTATCCGGATACGACTCGTCTTGCACGAGATAAACTTAAATCGTACCGTTGGAACTTTCTAGAAGT
GCCATTTTCTGCCTTTGTCGCAGTCCCAACATTTCGGCCAACCGTAAAAAGTCCGTCCAGGCTGGATGGCCTAAAGTCGTGGCGGAAGGACTAAACCGAC
AAAATCTGCCCATGAACTAAACAACAGTATTTTACCTAAATATTAGCGAATTAAATAAATCGTTTTTATAATCTTCATATTGGCCGTTGACCTCTGTTGC
GAGAAAGGTGTTGGCGCCCGTGGTCTGAAGCAGCTTCACGAGAGTAGAGAGCCGTGCTGACAGCACCGTGGCGAACGTATCGAATTTGTCAGCGGCGATG
CTGGCGTCGAACGGGTCCGTTGGTTGTGCGGCGGGCGAGCCGAAGATGCTCCGGGGTCATTCGCCGGGTGCTTCCGTGGATCTCTGATGCTGGTGTTCCA
CGATATGCTGAATGCGGCGCAGAAGATGAGGTGGTGCGTACGTTGGTGATTTCGTGGCGGCATGGTGGTTTAGACCTGTCGGTGAAGCTGCACACGATGG
TGTTGTGATCAAGCCAGTGTCGATACCGGCTGTGTCTGTGGCGTTGAGTCGCACGTCTGCTATGCTGACAGGAGCTCGTCTGGACGTCCAGGGCGTGAGC
ATGGTACTGCTTCGCTGGAGCGACTTCGTGCTGCTGCTCTGCGTGAACAGCGGCCGCGAATGGCGAGTCGCAGGCGAATCGCAGTGTGGGCGGATAAAGA
TCGAGGTGGCGATGGACACGGCCAAGGCAAGAGACTGATATTGCAGTTGCATCGGCAGCAGCAGACCAACTTGAAAATTTCTTAGTGACAGCTCCTAATG
ATATTGCAATGATTCTACTTCGAATGTAGTGCTAACTCTCTCTATCGAGATTTGACAAAATAGTTCTATGAGTGTTGCCTTCTGGCCACGGAATCCCTTG
AGAACCAAGTCTTCTTGTGGAATGTTTCGATCATTACGGGTGAGGAAAACCTGTTTGACCGCCTCTGCAATTTCTTCGAACTCGTTTTCTTCCTCGTCGT
CGGAGTTTTCTTCATTCGAATCTCTCGATGCTCTCGCGACGTTGTTTGATGTACTTGGATTGTTTTCATATGCCATGTAGCCAAGATCAATTTCAGAATC
GACAAATACATCACCTAAATATTCATTTCACGTCGAAAGTGTTAGAGCTCCATCAATATTGTCCCCAGGATCTTCAGTCTCGCTATCCTCATCGTTATTC
GTCGCACCACGCAGGGGTGACGGACTGGATAATCGGTAACTGCTTTCTGCACCATGCATTATTCGTCACTCATTCGGAGATATGAGAAGTTATTTTTTGG
GATCTGAAGTCTCAACCTTCTGATCACGGCGACGGACATGCTGAGCGACGATCTGAAAACCAAGCGCTTTCAATGCATCCATTTGATTGCGCTTTGGTGT
GTGGATTGATCCAAGGTCACTAAAACATCGCTCACACGTGGCCGTATTTACAGCAATTGAGAGCACTCTCACGGCGAGTTTCGGGAGGAAGCTCTGTGGT
CGTTCGGCTGCAACACTCTCCCAGTATTCTCAGGTAGCACCAATGAACTCACTCGGTTTCGTTCGCGTAAAGTGTCCTTTCATCCAAGCTAACATATCAC
GCCGTATCTGGCCGATACCCTCTGTAGCGAACAGCCGGCGGTAGTTGTTAACCGCAATCTTGCACAGCACACCAATACCAGACACGGAAGTATGGGGCAT
TTTCCTCGCGATTTCGGCGTACAAAGGATGCAGCGCAAATTCCAGCATGAACAACGGTTGCTCGCACTGTGCCCAACGAGACTCGATACAACCCACCAGT
GTATCACGACAAGTGATATGTTGCTGAAATCCATTGTGAATGTCGCGAAATGAAAGTACGACATCTCCAACCGTATTCTCGTCTTTCTGTAGCCTGTACG
ATGCGTAAGCCAGTGGTATGACAACGGCTTCCGCTTCCTTGACCTCATCCCAAAACAGGGGATCACCAAAAAGCTCGTAAATGCAGTGGAAGTTCTTCGT
ATCTCTTGTACCGGCTGTAGAACATTTGCAATACTGACTGTACGCGCAACAAAGATGGGAAACAGCCTTGCATCGAGTTCCCTCTCGATTCACAGATTTG
TAGTGCCAATGTTGTTTTCGTAGCATTTCTTCTTCATTTGGCGTGCTCGCCACAGCCATTCACTAGACGAAGTGTTCACATTTTTGACTGCTGTTGACGC
TCGGACTGTCACAACTTTAAACGAAGGTCGCAATACAGCCTTGACAAAGTTATTGACATCGTGGGCGAAACAAAAAAGAAAAACTATGTGCGACCAGTGA
ATTGTCAATATTCGACGAGTGCGTGCAGATTGCCTTGCGTTATCAATGACGATTGCTCCAACGCGTCACTGCACTTGCTGAACTTGCTCCAGTAGTTGTT
CGAGCTGCTTGGCAATTGTTACTCCATGATATTCATCTCCAGCGGGTAGTAGCGCGTATGTGAGTAAAACTCCAAAAAGCGAAAGCTGGCAGCCTAGCAA
GTGTTCCTTACAAATATTCATCCACGCGTCTGAAAGTAGGTTGAACCAGCCCTCTGTTGTTGCCACCACAGAGTTGAGCACTTCTTTATCCATCTCCTTG
CACCGATTAGCATGGTATTGTAGAACACATTTGCCTAAAGTACGGCGAGAAGGAAGAATATCCGATACCCCCGGGCACAACAGCTCCAAAACTCGGCGAA
TTGAATGACTCTCAACGAGCCGATCAGGGAGATGATTATCAGCAGGCGCTTCAATAATGGAACAGTCAAGTTGCCTAACGATGTACTTGTTGTAGGACAC
TTGTGACGCTTAAGGTGTTTTGTAAAGTGAGTGCATTTGGGGTGAGCGATCTCTTCTCGTGCTAGCTGAGCTACCCAATGCTCTACCTACTTCTACCTAC
ATGTTTGCTCAGCCGAGCATGGGCAAAGGAGCTGCTTGGCACCATGACCTTTAGCAATCACTCCAGTGCACTTCAACAACCTTCACTTGCATAACCTATC
AAGTTGACTTCACCTCCAGTACGGGATACTGATTGGTCCATGCACACATGTGGCCAGCATGAGTTCAGCATGGCTCTGGCTACAGTCCAGAGGCTGTCAC
CGACGACAGACAGAAGCAGGACTCCAACAGGCCTCAAGTGCATCATATCGCATCAGACACTCAATTCCAGACCCGCGAATAGCGCTCCCTCGAGGATTGA
GCAAGCACCCCTGCTTACAGTAGTGCTCCCAGAGGCTCGAGAGACTTTGCATGTCGGACGGGATCTGTACCTGCGTCCATCCACATCATTAGTTAGCAAA
CGAGACAGCTAGAGACGGTGACTGTCACGCCCTACTGCCCGCATCAGCCATTACGTTATCCACATCGACCACATTAGAAGCTGTCGAATAGAATTCGTGA
TAAACTTTTCAGATGCCACGGATCCGCAACATCCTTTGGGCAAAGCGCTTGTGGCTGGAATTGTGATTGTTCCAACTCACTCCGGAAGTATTATCGATCC
AGAAACGTACGTGGGTGGCCTCGTTATCGAACGAATTGTCCCATGAGTAACCCCATGCGAGAAAGGCATACACAGCGCTCATTAATTCTCGCACATTGAT
GCAAAATTCGTTGTCGCCTGTCTCGTTACAGTGACGAATTAGAACCCACTTTTCATTCGTGAATCTTACACGCACGTATTGTATCCGTGTTGGGAACAGT
GCGCACAGGCCTTGATCACTGGCGGCCATGTGAATGTGAAAACCAGGCTGCCGACGGCGAGTGAATTTAGTCATCGGAATCACATTTAATCTCCCGATTT
TGATGATTACCTCAAACCACCGCATATTACGTTTTGCCTCATCACATATTTCCACGTATCAAAACCGCGATACACTTCGAGCTAACGCTGCCACCCACTG
AAAGAATGGTGTTGCTGGTCTAATATATGTACCAACGTGGCGGATACTGCCCAACAACGTTCAGAGTCCCGTTCGTGTTGTCGTTGACCGGTCCATCATA
TCCCGAAGGAGGAGATGTACTTCCAACACCTTTTCTGGCGGCATCGACATCGTTTGCCAGAGAGATCCCAATCCAGTCCGAGTGCTTGCCCTTCTCAAAC
TAGTCGGTGGATTTCTTCTCGTTACACGCATCGGGTCCTAGTGCGGTGATCATCGCTGAACGAAGTGCTGTCTGAGCCTTCCACAATCTGGAACCAGAAT
CGGACTCAATCGAAATGTGGTCGTCGCACCACGTCTTATCATCAAAGTTTTGCTGTGTTTCTTCCAGTTGCAAAGGCCACCTTGGCACCGATCTCGCGTA
TTAGTAACTTCACTATAGCAGCTCCAGCGATACAGTACGACGAGGGAGAGTTTTTCCTGCCGAACGGGCAGCAGAGGTCCACTACAAGTACGCCAAGATC
CGGCGTAGTGCCTGCAAAGCGTCCCATCCGATCCACAAACATCGTGATATCGAGAAACGCCCTATTGATATCGCCAGTCACCATACGTTGTACCATGGGG
CCTGCTTTCGCCACATTCAGAGCACGGTTGGCCAAACCCTCAGGCCCGTAGTAGGAAACCTCCACCTCATGATCGGGTTTCGTGGTGTCGTTAACTGAGT
CACCAGGTGGAACTGATAGATCATGGATGATTCCAGCATTGATGGAGAGATCCACCTCAGTTTTTTGTTCAACCCCAAATGGACTACAGATAACATTATT
TAGTGTGGAAGCAGGTCGATATCAAGGATGAGGTAACGGTTTGAGTCTTGACCCGCCCACAAATGTTTGGTGATCATATTCACTGCACGTGAGGTGGAAC
CCTGATTCGGAGGCACTGCGACTTGTTTAAATTTTGACTTCCATTCTGGAACTACTCCATGATAGATAATTTTGTCCCAACGTGAACAGATCTAATAAGG
TTTCCATATAGGTAATCGGTGGGTACTTTCAGGGCTTTATTTGTACGGGAGTCGTGTCTAGTCTCACCTCACAGTAAACGAACAAATTCCGATAATTGCA
ACCCCGCACGGTGAAAGAGCTCACTGTATACAGATTCTTTGTTGCGATCAAGCAAGTAGATTGCTTTGCCGTTGTGAGAAGCTGAAGGAAGCACTGCCTT
TGAAGGGGAAAGCCTGTATCGCCTCAAAGCCCGACTCACCTCCGACTCAGCAACATCTACATGCAGCGGAGATCGAGTGAGGATATTTTTCCTGAAGCGT
TGCTGCTGATCTCTAACAAATTTTGCCAAAGAGGGTGGGTACTCAGGCATGTGCCTATTAAGCGACCCGAGTGCTCGACGACTTGAGTCGATCAAGCGGC
CCGAGGGTGGACAGACGCGGAGACGTGTAGTTATTGGTGATGCAATCACGGACAATATCGGGTAATGCGGCAGGTTTGAAGTGGCATATGTGCTTGATGA
CGCAAATACCATTCTTACCCCGACATCCTTGGGCAGGCAGATCTGTTTCTTGCCTTGTCGTAGAGCATCCTGGCGAACTTTAATTGGAATGGCTATCCAT
TTCTCGGCATCATAATTGCGGTCACTCCGTGGCTGATGGTTGTGGCGACTGGAGACCGTGTTGTTGTCTTCAATACAGAGGAAACTTCATGACGTACAAT
CAACTGATGTAAACGAATGAAAGTTTCGCGTGAGGCACTGAAGTGGGACTTATCCGTTCAAGTTTCTCCCAATGTCCCTCGGATATCAATACGCAAAACA
ACTCGAGTCAATTATCGACCCACGCGGCAATTTCGGACAGGGTCTCTGGAGATGGAGGCAATTCACTCGCGCATAGCTCGCCTAAGACACACGCCGCTAC
CGCGAGAGTATCGTAAATGGCAGGCTTGTACAGTTGTTGTGCCACAGCACGTTAGACCTCGACTGCTCCGATGATAATTGATAATGATTCAGGCATCAGT
GGTGTTGGGAGGGCATTCTGTCTCGAAACATTGCTCATGTCATTCCCTCATAGACGAGCCCACTTCTTAGGCTTAGCTACCCATCTAACGTGTAGAATTG
ACAGCCTCCTCGTACATAATAATCCCATCCAAACAGTGCACGTAGAACAGGAAAGTGTGGGAATAAACAATACTTTCTCCAATATATCTGTACAAATTCG
ACAAAACGCTGCGTTATCATCATCGCAACTTACCGTGTATAAACGCCAAGTGAATAGAAGTCTGTATACCAGTAGCATGAAACGGATGCATGTCAGCAGC
ACTCACCTCGTTATTTCTAGCCATGATTCGACCCACATTATCCATTGAGGTTCCATTCCGCTGCACATAAAGCAATTGGTAGTGCTGAGAAACTTCTGCC
ACATTCGCAACCTGCACGTCGCGCGAAGCCGTACCAATGTTGTTGCGATTGTATGTCGACGTATTACCTCTGGGTGCTGCACACCAGTAGTTCATGCTGT
CACCGCGGGAGCAGTGTTGTCGTCTTCAGAGTCACTTAGGCCGTCGCTAAGCTTAACTTCGGTCCTGCGCGAGTTTGCACTGTTTCGGCCGCTGGTTTGA
TAGCCACTTTGTCAACAACAGCAAAATTGCCAAATGTCATACCAGACAGAGGGGCGCGGCCACCTTCCTTGTAACAGACATAATCGAGGATGTGTCGAAT
TGACACTTCAGGCACCTCGAAGCTGATAATATCAATAAGAGATATAACTATGGATCCGTCAATTTTGCTTCCTTCGACAGCAGTGAGTAGCATCGTTGAG
TCGCGAACGGCGATCTCATTCATCCCGTCAAATTCGTTGTACACCTTTTCATGTTTTAGCTGCATCTCATGGCGAGGCTGGTACTTTGCCCCCGCAAGGT
CGCAAAGCGTATACCTCCACGGAGACGTCCTGGGTAAACACGGGCTTATACATGACGGGAGTTGTTGCGCCCCTAATGTTCACATCGAGTCAGCCTTGCA
GGTTGTTTGACTTCCACTTGTACCCAACCACCAGGCCATAGTCCCAGATGCGGGCTCCACGTGGTCTGACCCTGGGCGTACAGATGGCACTTCCCACAAA
AATGCCGGCACCGCCCAAAACTTCCTCTGCATATACGGCTCGAGGGGTCAGCTCCGCTTGCATCAAATCGACCCACTGCCTTTCTACTTCATCCCAGCGT
TCACTCACCACCAACGTCACCTTCATGCTGCTGCTCCGCACAGGCGTCCCTTCCGTCTTGCCAAATCCAAAACCGACAAGATCAGATTCCCCAGGGCGAC
GGTAAAAATAGCTTGGAGTCATGAGCGACTTGTGGGGCTCGTTCGCGATGGTTATCTAAGGCGAAGGGGATTTAGGAATGAGCAGACTTCGAGCCTCATT
TCCCCAAGCTCATGCCGTACATATCTATGGTATCACTGCGCGACGTTGGGAAACCCCGCCTTCATCAGCAACTGCTACATCCTAGGCTGCTTCTGTCGCT
TTCGTGACCACCAATTTTACTAACGAGCTTCATCCTTTGAGGGGTGCGCCCTGTACGCATTGCAAAGGCTTCCCGCTGCTTCACTGAATAATGAAACCCT
TGTACGTGGTGAACGAACTGGTACACGCTCTTCCATGTCAATTGATTGAAGATTATCGACAGCGTTGTCAATAGCTTGATGTCGCCAGCCTGCTCTTCGT
CATTGTATGCGTCTGTACCACGCTTTCTCAGGGCCCTTTTGCAGTCGGCCGAAGCGGCCTCATCTAAACGAACGGCCAGTTTTGACACCCTCGTTTGGTC
TGCATTCGATCTGGCATCGGTAGTGGCGGCGCAAATAGTAATAGTCCTGACTTGGACTTAGCACGTACGCATGATGGGGCGTCAGTGGAACTTGGACTTC
TGCTGAGTACGGCGAGTTGAAGAATTCGCTCAACCTCCCACGCCACGCTCAGTAGCAAGTAGCGCCAGACCAACCACCACTTGACCCATGCAACCCAGTC
TCAAATGAATTGTCGTCCAAAGCAAATAAGTATTTTTTTATGCTGCAAGAGCACCTTACTCTTGATGAAAAGCTGCAATAACAACAAAAATCTTCGAAAG
GTGAAGACAAGTTTTTGAGCAAATTCGTCCAGAGCATGAAGAGAACCTTTCCTCGAATGGACTATTGATCTGACTTCGCTCTCACAGCGGAAGTTGCTTG
CGCAGCAGCTTGCCAGTTTTCAACTGTCTTTGTTTCTCTTTTGCTTTTTTTTTTTTTTTTTTTTTACCTTTCTAGCTGCTCCTATTCTTCCATGGATAGC
TACGTGCTATCCGTCTATTGTCGACACCCTGGGTACTGTACATACCCACTTGATTGCCGACGCACTTGGGTGCAGATCCACTTCTGGCGACTCTGCCCGC
ACGCAGTTGCATGCACGGCGGCAGAACACTTCCCCCCAAAGGGTGAGGAAACCAGACGTAAAAACGCAGCACCATCATAGAGACATGTCCGATCTACGGA
CGTCTTGCTGAACCGCAACGGCGTCCAGCACTTTGCACTGCCCCAATCATGTTCAGCGCCTTCGCCATTTTCTGCACCAGCGTATCGGTCTGGTGTTCCT
CGACAAACTCTTCCACAAGCCTTGGTTGGTCTTCCAGCATGATACGAGCAGGCTCCCATGAAGGCTCAAGTTCATCTAGACCGAACCACTTAACTTTGAT
CTCTCAGGCACGTAGTTCACGCCCAAATCGGCATTTGATGAACCGTTCAACCAGATGACCGCCCTCGCCGTATGATGTGCTGAACCAGGTCGTCGGTCAC
CTAACAACCAGCTTCCGCATACAGTTTTCATCCGGGACGCATGGACAACCTGAATGTCAAAAGTCTCCACAATATTTTGCACTTCGAAAGTGTAGTCATT
GAGAATCTTCACCACGCGTCGTGGACCTTTCCAGTGGATCGCCAATTTATTTGCTCGAGACAGCACTTGCCCAACGAGAACGAAATCGCCGAGGGAAAAT
TTAATGAGCACAACACCCGATCGCGCCGCTTGACACTTTCGAGCTTGCTCCCGCTTCTTTGCACTTGTTTCTGTCAGTCTCTTGTGCATGTTAGCCAGCG
CTTCCTGGATCTCGACTAAATGGTCCTTCTGCTTCTGCGCGACCCAATCTAGACTCACTAGTTCTTGGGTGCGTGGATGTAACAGAGTCCCAACGGGTGT
TTGAGCTGGAAGCGCAGTGAATGCTGTCACTGGTGCCATTCCGCCAAGTCTGTCAGCTGGCAGCTGATTCAATGCCATCTGAACCACCGGCAAAACCTCC
GTCCACTGACTGATTGCCAGCCGCTGCTCACTCAGAATTGCTTTTATGCACCGCAGGATCAGCCTGTTTACCGCTTCCACTGTTCCGTTCGCCCACGGCG
AGTAGGCAGTGACGAAATGGTGTTGAGCTCCCAGTTTCCGCCGCAGCAACTCGATAAGCATGTTCTTGAAATGGCTGCCTTGATCGGAGACCCACTGATT
CGCCACACCATATCGCTTGAATCAATCGGTCAACGCGATAAACACTTCCGAGCTTGTTGCTGCGCAGCACGTCACTAACTCCACAAATCCACTCATGTCA
TCCTTTAACACCAGGATATAGCACATTTCATTCGAGCTTTCAGGCATACTCAAGTAATCAAAATGGATCACTTCGTTCGGCTTCGTGGCATGCACTGCCT
CACCGAACGGCCTGGGACCTTTGTGCCATCCACCCTCATGCAGTGCAGACAGCCGTCGACGAAATTTCGCACCGACTCGTCCATCCCATCCCAAATGAAC
ACATCACTCAAGTGCTTGAGACTAGCCGCAACACCACGATGACCAGCGGCCCCCGCATGTGCCACAATGCACAGTCGTGTTTGCAAGTTGGTCTCAGTGG
GAGGAACCCAAATCCTGTCGCGCTCGTCGCGATAAAATTCGGCTGCTGAATCCCATCACACATTCGCAGGCGGTGCGTTTGCTGAGCTCTCCTCCACCGA
AAGAACCCCACCGAAATGCTTTTTGACCGCCTGCCGAACCTCAAGTTGAGTTGGCCACACGAAATCAGCGTCCTGGAGTGGTGATATCGCAAAATTTTCG
TCCACACCAATGACTGCAACGCGAACTGAACGAGCTCCACGTGTAGTCGCAGCATCAGACCCTCCCCATAGCGACAGCAAATCGGCCCACGCGTTGTCTT
CTCCTGCAATGTGCTCGATCGCGTAGGGGAACATAGATAACGCGATAGCCCGCCGTTGCAAGCGATCAGCTTGATAACGCGCAATGCCACAGTCGAAAAC
TTCAGGATTGAAGATGTACAACAGATTTCTGTGATCCGTGAAAATTGTAAACCCCTCAGGTCTCAGCAGCAAGTATTCGAGCCGTTTACACGACTCGATA
ATCGTGTAAGCCTCTTTTTCTACGATCGGCTAACGTGACGATGCACCAACGAACTTTCCGCTCAAGAATGCAAGTGGCGCGTGACGCTGCTCTTCTAGCG
GCTTACCAGAGTCACGACAGATCCCCAGAATCTTGCACTTGCATCCGAATACAGGCAAATCAAACTGGCAGCTTTGGGATGCGCCAATGGCACCATTGCT
ACAAGCGCACATTTCAATGCAGTCACTGCGTCGACATGGACAGCGTTCCATCCAACCGTATCCAGCAAGACGCGAGCCAGGATCTTCTTTTTCCGACTCT
GCACAGTGTGGTGAAGTGGATGTTGGAAATTTCGTGATGGACCAACGATGGGCTAGGATCGGACGGGACCGGACGTACGATCGGAGGTTGATGAAGGCAG
ACTTTGGAGGGATTAAATTGGACCTGAGGGGTAGGGGTATGGAGACCCAATGGGTACAGTGGCGCCATCAGTCATCGGTGTATACCGGTATGCGGTATGG
TGTGATCATTTCGATATGCGATCGTGGCCACCACAGCGATCGCGATCCCGATCGCAAATGGCGATCGTGACGTACCACTTTGGTGGTACACCAGCAATCA
TTCCGGAGTAAAAGATCTGTGGAATGTACCTCGGAAGATGGGTGAAAGAATCCAGTAAAGGGGGGAGATAGGAAGCTGAGGTCATTGTTTAATTTGTTAA
GAAGAAGCTTTCCCGTGCAACACAAGTGGCGTTCGTTCATTCCAGGCTGGGAAGTATATTGGCCCTCCTGACGACTTCGGACTCACCTCGTCGCGCAAGG
TAATTACACGGGAGCCCCTGGATCGCTTGGCCAGGTGCGCAACCACTTAACCCCCCCCCCAGAAGACCCCGCCATAGGAGGCGGCAAGCACGTAAAGGAA
CACACCCAAGGACACCCCCCACGCCGATCAAGCCCCACCAGGCCCCGATCAGCAGACCACCGACGACCGCGTGAAGAATAACCGCGTGGACGTCACCCCC
CAGTTCCCCGGAAGGAGCCGTCCAGCTCCCCACCCCATCCTGGTAACCACCGACGCCTTCAGTGAACACCGGAAGAGCGTAACCCGCCCCGCCGTCGGGT
ACACAAGGTGAATACAAGGTTCCGATCGCGCCAGATCAACGGAGTACCCCCTCCGATAGTCGGCACTCCGGGCGTACCGCTGGCAAGCCGGATATCACGA
CAGCAATTTTCGTGATCCCGCTTCGCCACAATGGTGCGCGTGCCCGGATCTTCTGGCGATTCACAGGGATTTCACCGTGAGTCCACAGAAGAAGACGTCA
AAATCAAGATGGAACCAGGGAACGAGTCGTCGACGGAAGAAGGATCGCCGCCGACGGCGCTGAAAGCACCAGGATCCACTGATCGTGAGAGTGCCGGGAG
GAGCTCTGACGATGTGAAAGAGGAAGGTTCAGCGATGGACCTAGAAGAAAAGCCTCAAACCCCTCCCCAGGTCCCCTCGGGGACCCCCGCGGATCGCGAT
GCGAATCGTGATCCGCCGGACGAAGGTCCGACGGTGAAAACCGAAGGACCTTCATCCAAAACCACTCCTCCAGCCTCGCACGCAACCTCGAAAAAGAAGT
CGAAGACCTCACGCAAGAAGCTGAAGGCACCGGAGTCTGAAGCCGAAGACCAGGAGGATCGCAACACGTGGACGGACGAGCAACTGGAGTCTGCCTTCTT
CTACAAGGACCTTTACAAGTTCCTGCACGAAGACCCTGTAATGAAGATCGTGCGCCCGAAGCCAATTGGGGAACTGCAAGGTCCAGTGAAGGCACCGAAG
GAAGTAACCAGCCAACTCGAGGCGGTGAAACTGCTGATGCGTATGCTAAAAGAAGCGGGAATCGTGCTCGGTTCCTTCGACGCGAACGAGCTATTCGACT
TGGAATTGCCAATCATCAGGGAATCAACGCTGAGCCTGTTCGCGAAGCTGACGCCCCTTGTCGGTAGTGTCGTCCCGGTTCAACGTGAAAGACCAACACC
GACTCGCAGCCAAACCGGATCGTCGCAATATGCCTCAGCCACATCCGAAGCGGGATCGGACAGCTCGATCGAGCTGCAGCGGATGACACTTGGGCCGGCC
GGAGCAGCCATGCTACAGTCGCGAAAGGAGAGATCGGAAACCAAGCCGACAGTTATCGCGACGAGCGATCCAGCCCAAGCCCCCCCTGAACGCATGCAAT
CGTTCTTCAATGCAGCAATGGAGCGTTCCTGAAGGAACAGCAAGCGGTCTCGACCACGCCAGTCGTCGACCAAACCAAGCCACCTGGAGCTCAAGACGTT
GACATGGAGTCCGTGGAGTCGAATCGCCGGGACCATTCGCACCCGACCGAATACGATCCGGATGACCTGGGTGTCGACGCTACCCCTCGTGCCGCAGTCG
CATCTGCTGGGACTACAGGCGGCGGAACACTCTCAGCCACAAGGATCCGAGTCTCCACGATCTCAGAACTGAAGGAATTTCCGGGGAAGGACAACGACGA
AGATCGTGCCAGAAGCTGGTTCGGCAAACTGAAGTCTGCCTTTGTCCGCGATCAAGCTCCTGACGGCGAGAAGTGTCTGGTGTTTGGAGATCTGCTCACT
GGACCCGCACGTAACTGGTACCGACAGCTGAGTCGAACGCCGCGCGGCAACTGGAAGAGCTTGTCTAAGAACTTCCAGACTCAATACTGCGGACGTGGCG
TGTCTGTCGCGAGACAATACTACCATGCGCGAAAGCGATCGGATGAATCGCCGCTGGAATATCTGCACCGTCTGAATGTCGCCGGTCTGCGAGCTCAGCT
CTCGATCAAGGATGGATCGATTGAGGTCCGCCGTGAACATGTCGATCACTTCATCGAAACACTCGACGATCGCGATCTAGCCAGCCAACTGGCACTGCTA
AGAATCCCGGACGCAGACACTCTCGAAGAGACACTTCGATCCCGACAACGTGCGAAGGCGAGACAAGGAAAGACGGTGTATGGGTCCATCAAACCCAAGC
AGAAATCACCCACGGGGATCACCCCATCCGCGAATGCTCGCGCAGTCCGCGCAACAGTCAACTCGAGCGACTCCGAATTGGAAACCAGCGGGTCGGAGGG
AGAGGGAGACCTGCGCAAGGTATACTTCGCGGCAACGCCCGATCAGCCGACCAGATCGCATTCGGATCAGGAACAACGCCACCCTAGTCGAGACTCCAAC
GACCGTCGCCTCGATCGTCCAGCCGGACCTCTCGAGGGGGAAGTCCCGCGGAAGCCATGTTCCCACTGTGGATCGTCGAAGCACACCGATCTTGGTTGCT
GGAAGCGTCTGACGTGTGAAAAGTGTGGCAAAAAGGGCCACCCGACCGATCGCTGCCTCTTCATCTGCAAGGCCTGCGGCGAGATCCACGGAGCCGGAGA
ATGCCCGATGGAGGAGTTCTATAATTCTGGATGCCGCCTTTGCTCGTAAGGTTGGGTGCTACATAGACAACAGTCAAGAGTTGGAATGTGAAGGAGTTGG
TAAGAATCCCTATATGGCGGATGGGCGTACCAGAATCAAGATCACGCTCGCTGGATCACTGGTGTACTACTTCGACGCGTGGGTTGGTCCGCCCACAGGC
GGCCAAGACCTGATCCTGGGGATGGACTTCATGATGCCAGCTGGCATTCGCCTCGATCTGGCTGATGGATCAATAAATCTTCCAGACGAAGTGCGTATTC
AGCTAGCCGGCCGACGTCTGCTCTACGGAGAGAAGGTCACGCAGGTCAAACTCGGAGAGGATTGCCAGCTGGAAGTCGGAGAGTCGATAGAGATTCAGAA
GGGTTTCATCTTGTCGAGCCACCGGAAGCTGTGGGTTACTCGAGGAGATAGATGGGTACCAAGTCTTGTGACAGGGTTGGGGAAAACTCGCTATCTGAAG
ATCACGAATATCAGCGATCAGAAGTTAGTATTGCAAGACGACACCCATGTCGGCATGTGGCTTGAAGGAGGACGCGTACCTCGCATTCCCGGTTTCGTGT
TACCTGGATCGCGCAGATATGCCGAGTGGCAGAATCTAGCTTTCCAGTCTACTACAGACTGTGTGGAGGTAGAAGAACATGAACTCGCTCCTACCGGACC
CATGGTAGATCGACCTCAGTACGACACACCGATGAAAATCCTGCGTCGTGACCGCGGAACCTCGAGATCAGTCGTCGCACAACTAACCGTGCCTCGACCC
GCCGAGATAAAACCAGAAACTGAGGGGTCTCCAAGGGATCAGGAAGGTGATACCAGCGATCAGGACGCGAGAGAATCGCCGCCAATTGAGCAGGCCACAC
GAAGTGAGATGACTGCGGACCAGAAGGAGTCTATGCCCCAGGCCGAAACGCCTCCGATCGTTAATCCGGAACCGCTGGATGACGAAGAAGTATGTTACCA
CGAAGGTGGCGACCTGTTCGCGGAAGATGCGGAAAGACAGATGACAATCTTGCCGGAAGTAGTGACCACCACCGATGAAGTCACGATCGAGGATATCCAG
GTGGGCGATCCTGAGTCAAACACCCCGGAAGAAATCGATCGCCTGCGGCAGATAATTTGGAGGCGGAAACATCTCCTGATCGGGAAGGGGAACGCGTTAC
CACCAGCTGCCGTTGGCGCAGTCTGCGACATCGATGTGGGAGGAGCAGCTCCTGTTGCACAACGTGTCCGAAAAGTCGCTCCACAGTTCCGTGAGAAGCT
GTCGGATCTGATCAAGAGCCTGTTATCGGCGAAGATGATCACGCCGTCGACTTCACCGTGGGCCTCTCCGATCGTAATCATCATCAAGAAGAACGGCGTT
GACATCCGGCTCTGTATCTACTACAGGCTGGTGAATAGTTTGACGAGACTGATGGTGTACCCCATGCCGCTGATTAGCGATCTCTTGGAAGACTTGGACA
AAGTGCTCTGGTATTGCTCACTCGATATGGCAAGTGGCTTCTGGGTGGTCTCCATGACAGAACGCGCACGGAAGATCTCTTGCGTTCATCACACCGTTCG
GGTTGTTCGAGTGGACGCGTATGCCTTTCGGGTTAAAGAATGCGCCACAGATCTACCAGCGATTGATTGATAACGCGCTGTATGGACATCTCCGAATCTG
CGCCGGTCACGATCCGTCGGAACCGATCGACGTGTTCGATTCAGGCGAACCAGAGCCGAGACCGTCAGTGTTGGGAAGGCGATCGTACATCGATGATATT
CTGGTGACTGCGATCACTTGGGACATGCTGTGTGAGAAGGTTGAAGCACTGCTTGATGCTTGCGAACGATGGAATTTGTCCATCAGTGTGGTCAAAAGTT
TCTGGGGCCGACGAAAAGTGGACTACGTGGGACACCGAGTGTCCGTCGACGGTTTGGAAGCCCATCCGAAAGATCTTGAAGTGTTAGGCAACCTTCCCTT
CCCGCAGACGCTGCGATCGATGCAGTCCTTCCTTGGAAGTTTGAACTACTACAGTCGTTTCATCGAAGACTTCGCGGTCTACGCCGCTGTCCTGTACGAG
CTGCGCGAAGCGGATTTCCACGAGATAGTTCAGCAGAACAGGTCCATCCCCGGCGAACAAGTAGCTGGGGGCGTTGTCACGCAAGTAGAAGACGCTGACC
GTTGGGCCCGAGCGAAAATCGCATTCACGATGCTGAAGGCCAAGATCGTGTCCACCCCGGTACTGAAACATTTCGATCCAGATCGCACCCCGGTGATCGT
AGTCTATGCGAGCCAGTGGGCGATCTCCGCGGCACTCGTACAAGGGCATGATGGCGTGTACTGGCCAGTAAACTTCACCAGTCGTACTCTGAAGCACAAC
GAGATCAACTACGGGATTGTCGACAAGGAAGTCTTGGCACTCCTGCGGATGCTAGACGTGAATTACACACTGTTGGCGACGAGGTCGATCTTGGTGCTGT
CCAGACATTCGACGCTGGCGTGGCTGGTCAACTCGGCTGGCTTCCAGGGGAGACTGGGTAATTGGGCAGCTTTGTTGTCAGAATGGACGTTAGAGATCAG
GAAGTGCACGAAAGGGGAGGATGAAATTCTGGGAGCGATCGCAGCAAGCATCACACCTCGCGCAGAAGTAGACGAGGCGTTGATCGCGATTGCCCCAGTG
AAGCAGCCCCGACTGATAATCACCATGCCACCCCCTACGGTCGAAGCGGATGAAACCTTGCTGGTCGCGAGTTTCGACGGATCAGCGCGTGTCAAACGCA
GTGGTGGCGCTTATAGCGCGATCGTGTGGAAGCTGCCGGAATGGACGATCGTCACGGCCACATCGGAGTACATGTCTGATCTGACGGTGAACGAAGCTGA
ATATCGCGGACTGTTGTTGTGCTTCGATCTTCTGTCCACTATGGACAGAGGGCGGGTCGTGATCTGCGGCGACTCCAATTTAGTGATCCGGCAAATGCGT
GGTGAGATCGCATGCAAGGCCCCTGGCCTGTTGTTATTGCGCGAGAAAGCGATGGATCGGCTCCGATCGTGGCCAAGACACGAGTTCTTACATATGAAAC
GAGATTGGAACCAGAGCGCGGACAAGTTAGCTAGCGAAGCTCTTCAACGGGGCGAAGAAACCGTAGTTACCTTGGAAGCTGATCGGCAGGACCTGATCAC
ACTCAATCGGCTGGACGAGCTCCTGAAGCCGAAGGATAATAACGCTGTAGCTCGTGTATCAGCGGTGACGCGATCGGCACGACGGTCGAGACGAGTGCCG
GGAGTTCTGCAAGAAGCGATCGTGCAACGCATCAGAAGTGAACGGATCACGCAAGCCCAAGACGAAGAGCAGTGGATCGCGAACATGAAATCGTACCTGC
GGGGCGAGGTGACCGACCTGTCGTCGAACGATGCTAAGTCCTGCGCCAAGACCGCTTGCGATTACGAGCTGGACGAGAGCGGACTCCTGCTGTACTGCCC
GACAAAACCGCAATCGGACGAAGACCGAGACTCCCTCGCGCGGCTGGTCATCCCGGAGACGCTACAACAAGACCTTTTCACCGGATACGTGATCGCGAAG
GCTAGCGCCTCTCGCACTGCCCAAACGATCGCCGAGAATTACGAAGAATGCGTCTTTCGACGTTTCGGCGCCAGTGAGGTCATCCGCCATGATCGAGAGC
CCGGTTTTATGTCAGATTTCTTCCGTGCTTTTAGCCGGATAGTGGGTCAGAAACAGAGAGCTACGATGGCGTACCGGCCGCAAGCCAACGGAACTGCCGA
ACGAATGGTGCAGACTCTAACGCGATCGCTGAAGATGTACGTGTCAGACGTGAACCAGAGAGACTGGGACGAGTACGCGGAGCGACTCACGTTCGCCCTA
AATACTGCCCAGGATCGAGTTCGTGGCGACACGCCATTCTACCTGGCCCACGGGTGGGACCCGCGATCGACGCTGGAGGCGGCGATACCGTTAGGCAGCA
CGCGCCGACGCGATCAGGAGCCCCGTCGATGGAGGTTCCACGTACAAGAACACTACCAGCGAGCGCGGGAACAGGTTCGCGAGCGACTGCGCGAGGCGAT
CAGAGACAGAGCCAACTGACACAACGAAGATCTGCGGCCCCACAACATCGCGATGGGCGCTCAGGTATGGCTACACCTCGATCGAGTCAAGGAGGGGTAT
GCACGGAAGCTCGCACACCTGTGGCATGGACCTTTTCGTGTCGCCGAGATGATCGACGATCACGCCGCACGTCTTGAGATCGCGGGTTCGGAGTATAGGA
TCTTCCCGATCGTGCATGTGTCCAAATTGAAGTTGGTCCGGAGGTTTCCCGATCGTCCTGACGCGCCGTTGCTTGTGGCCGAGAGCGATCGCCTGGATTT
CGATGAGGCCCTCCTGCCGGAGGACAGCTGGGAGACCCCACTCGACGAAGGCGAGTTTGAAGTGGAGAAGATCGCGGATGTAAGAACCGGCCGCCGGACG
CGCTACGGACGAGTCCACCGAGATTTTCTGGTGTTCTGGAAGGGTTACGACGATCCAACTTGGGTCGATGAGGCAGACCTTAATTGCGGCGCTATGTTGC
GCGACTTTGAACGAGGACTGACCAGCCGGAACAGATTTGAGGTGATGCAGTCCCATGAAGGGGAAGCGGAAGACCCCCTGCAGTAACAGACACTGTAGGG
GAGGAGGAGAATGAAGGATGTGTGGGATGGCCGCACATCGGAGGAAGGGGTAATTTGTGAATTGTGAGTTTGCGATCGGGGAGGGAAGAGGCCGATCGGG
GTCGGGTGACCCAATAAAGAGAGAAAGAGAGGAGAAAGAATGTATTGCAGAAGCTTATCAAGACCTCGGAGAGGGTTACTTCACTCAGAATCGACGATGG
ACCGAAACTTACCGTCTAGGCGTGCGATGCGGGACCCGGGATAATCGCTCAGTTGTGTGTGATATTGGTTGCGCCACGGGTCAGCCGAATCGGCGGTAGG
AAGAGCGTTGATTAAGTCAGGGGGCGCCCGCGTGGCTCCAAAACCGGGGTACCAAAAGCACCTTTCGTTTTGGCGCGGAAAATGAAGGAAGAAGGGATCC
AGAAGCAGGTCGAGATCGCAGTGTCCAGCGATCATCCCAGCCAGTAAATGCTTGAGGATGGTCTGCCACCGGGGGCCAGCGCGAGATCGACGCTGTTTGC
ACCCGAGCCAAAACTTAGCCAGAAAAGGGTTGGCCAACTTCATGGCCTTGGTGATCGGTAGCTTGTGGGTAGACTTTCAGAATGCTTGACGAAACTCCTC
TTCGAATGCCGCGTACAACTGTACGAACTCCGCGAACCACCCTGTCGCATCAAACGATCGCGGCGGAACTACCCGACCCAACACAATCCATGGTCGCAGT
TTATACAACGCCAAGATATTAGCCTGGGTGATCAGGCCGGGGCTCCAGGTGCCAGCAGAAGGAGCGCGGGTCCGGCGTGGGAATAGCCAAGATGGCGGAC
GACTCCACTGACGAAATAATGTGGCGACCGTCAAATGGCGGACGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTCA
ACCAGATGACCGCCCTCGCCGTATGATGTGCTGAACCAGGTCGTCGGTCACCTAACAACCAGCTTCCGCATACAGTTTTCATCCGGGACGCATGGACAAC
CTGAATGTCAAAAGTCTCCACAATATTTTGCACTTCGAAAGTGTAGTCATTGAGAATCTTCACCACGCGTCGTGGACCTTTCCAGTGGATCGCCAATTTA
TTTGCTCGAGACAGCACTTGCCCAACGAGAACGAAATCGCCGAGGGAAAATTTAATGAGCACAACACCCGATCGCGCCGCTTGACACTTTCGAGCTTGCT
CCCGCTTCTTTGCACTTGTTTCTGTCAGTCTCTTGTGCATGTTAGCCAGCGCTTCCTGGATCTCGACTAAATGGTCCTTCTGCTTCTGCGCGACCCAATC
TAGACTCACTAGTTCTTGGGTGCGTGGATGTAACAGAGTCCCAACGGGTGTTTGAGCTGGAAGCGCAGTGAATGCTGTCACTGGTGCCATTCCGCCAAGT
CTGTCAGCTGGCAGCTGATTCAATGCCATCTGAACCACCGGCAAAACCTCCGTCCACTGACTGATTGCCAGCCGCTGCTCACTCAGAATTGCTTTTATGC
ACCGCAGGATCAGCCTGTTTACCGCTTCCACTGTTCCGTTCGCCCACGGCGAGTAGGCAGTGACGAAATGGTGTTGAGCTCCCAGTTTCCGCCGCAGCAA
CTCGATAAGCATGTTCTTGAAATGGCTGCCTTGATCGGAGACCCACTGATTCGCCACACCATATCGCTTGAATCAATCGGTCAACGCGATAAACACTTCC
GAGCTTGTTGCTGCGCAGCACGTCACTAACTCCACAAATCCACTCATGTCATCCTTTAACACCAGGATATAGCACATTTCATTCGAGCTTTCAGGCATAC
TCAAGTAATCAAAATGGATCACTTCGTTCGGCTTCGTGGCATGCACTGCCTCACCGAACGGCCTGGGACCTTTGTGCCATCCACCCTCATGCAGTGCAGA
CAGCCGTCGACGAAATTTCGCACCGACTCGTCCATCCCATCCCAAATGAACACATCACTCAAGTGCTTGAGACTAGCCGCAACACCACGATGACCAGCGG
CCCCCGCATGTGCCACAATGCACAGTCGTGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNAGATGGGTGAAAGAATCCAGTAAAGGGGGGAGATAGGAAGCTGAGGTCATTGTTTAATTTGTTAAGAAGAAGCTTTCCCGTGCAACACAAGTG
GCGTTCGTTCATTCCAGGCTGGGAAGTATATTGGCCCTCCTGACGACTTCGGACTCACCTCGTCGCGCAAGGTAATTACACGGGAGCCCCTGGATCGCTT
GGCCAGGTGCGCAACCACTTAACCCCCCCCCCAGAAGACCCCGCCATAGGAGGCGGCAAGCACGTAAAGGAACACACCCAAGGACACCCCCCACGCCGAT
CAAGCCCCACCAGGCCCCGATCAGCAGACCACCGACGACCGCGTGAAGAATAACCGCGTGGACGTCACCCCCCAGTTCCCCGGAAGGAGCCGTCCAGCTC
CCCACCCCATCCTGGTAACCACCGACGCCTTCAGTGAACACCGGAAGAGCGTAACCCGCCCCGCCGTCGGGTACACAAGGTGAATACAAGGTTCCGATCG
CGCCAGATCAACGGAGTACCCCCTCCGATAGTCGGCAGTCCGGGCGTACCGCTGGCAAGCCGGATATCACGACAGCAATTTTCGTGATCCCGCTTCGCTA
CAACAGTATTAGTTGCCACGTCCAACAGCTCGTACAATATTCCTGCTAAGCTTGCGTAGCCAGGTATACTACTGCACATCCAGTTGATAGCGCAGAGTAG
TTGCTGTAGATCCGCCGCAGTCTTGGGCATTGGCATTTCGACCAGACCGGTCACTCGCTCAGAGCAGTGCGATATACCACCGCCACTGATAATTCGCCCG
CACCACTTCACCTTTCGCGTGAAGAAGTGACACTTCTTCGGATGTAGTTTCAACCCGAACTCAACACAACGTTTGAGCACCTTCTCCAAAAGGCACAGCA
GGCCTTCAACTGAGTCTTCATAACCGAGAATGTCATCCAGCCAAGCTAGTACACCATGGTACAGGAGCTCACCAAACACTTGTTCGACGGCGCCTTGGCA
ATGTGCTACCGAGTCCGTAGCCCCCATTGGCACCCGTGTCGGTGTGTACA