Description :
From Genome Similarity Track
Location :
Scaffold_554:5383- 9638
Sequence
4255 bases(100 bases per row)
GACAACGCACTCTGGGGATTCGTTCAACCTAAAAGAGGTTGGTTTGAATACTCGGAGAAGATGCGTTTAGCTGAAGAACAGGCCAAGGAACGTCGTGGGC
CAAGCGCCGAGGGTTCGTTTCAAACGAAGTTCGCGGCAGACCGCGAAGCACCGGTAGAGACCGACCCTGTTCTACAACTCGTCAACAGCACCGTCGCTGA
CATGTTTACGAACGGGGAACCGGACGAATCATCGCTGGTACCTGTATTTGGTCGACGGTCGTTTGTGGATGACATTTGCTTCGGTGGCGAGGATTTCGAC
AGCTGCCTAGCGACGCTGGACCGATTGCTAGCAAGATTTGCACAGTGTCGGATCAGCATTAGCTTCACCAAGAGCATCTTCTGCCAACCCAAGGTGGACT
TTCTGTCGCATAAAATTTCGCCAGAAGGTATCAGGGCTGACCTCAGGAAGCTTGCGGCCATCACCGAGCTTTCGTTTCCAACGAGTAAGAAGGGCATGCA
GTCGTTTCTTGGAGCGGTTAATTACTACAGTCGCTTCATTCAAGACTTCGCGGTCTACGGGGCGGCGCTGTACCAGCTCAAGGATGAAGACTTTGCCGTT
GAAGGTGGCCTTTCTGTGGCACGTCGTTCCTTCGAAAAGTTGAAGACGAGTGTTTCACATTCACCCATCCTCAGGCACTTCGATCGGTCGAAAGCAGTTC
ACGTCATGCTCTTTGCGAATGAATGGGCGCTGAGCACTACGCTAATGCAAGAGCATGAATGCAAGTTACACCCCGTACGGTTCCTCGGTCGAGTGCTCAA
GGAGGCCAAGATGAACTACCATCCTGCTGAGAAGGAAGTTTTGGCGTTACTTCTGCTGTTGAAGATCTGTTACGTCCAGCTAGCAGGAAAGACGCTACAT
GTCTATACACGATTCTCGATGTTAGAGTGGGTGCATAAGTCGAAGTCTCTCTACGGACGCGCGGTTCAGTTCGTAGTGCTGCTATCGCAGTGGCACCTGA
AGGTGCAGTGCGTGAAGGAGAAGGATGTCGCCTTCGCGCAGCTACTGCAGTCAAGCATCACGAGCTTCGTTGACCTGGAAGACTCGCTCGCGCCGGTGGC
ACCTCCAAACAAGGGTTCCCCGACTATTCGAATGGACCCCGCGTTGCTGTACGCCAAGCTTTCCCGTAATTACAGCGGATTCGTCATGTCTTTTGACGGA
TCAGCGAAGACAGAGAAGTACGGTGGCTACGGGAGTTGTTCATGGGTGCTGTGGAGCCTTCCTGAGTGGAAGGTAGTGATTGCTGCAAACGCTTACCTCT
CGGCCACCACGGTGAATGAGGCAGAGTACACAGGGATGATTAACGGTGTAAAGGCTGCTATTGCGCACGGTGCCGAGGATTTAGTCATCGTTGGTGACTC
AAGGCTCGCGATTCAACAATCACTAGGGGTGATCGCATGCAGGAAGGAGACTTTGCTAGCGCTGCTGAATACTCACAAGGAACTGAAGGCCAAGCTTTGA
TCAGTTAAATATCTTCACGTTGTACGAGAATACAACGCTGCCGCGGATTCGTTAGCCACTGAAGCGCTGGAATCAAAAGTCAGTCGAGTCATCTTGGCTG
AAACTCGCAAGTCGGAATTGGCGTCGCTGAATCGCATCCAGGAAATGATCTACGAACCGGATGAAGACTCGGTAGATGTTTCGTCACGTGGAGCAGAGCG
TCAAGTACATGTACTGTCAGGCAGCGAGTCTTCAAAGTGGAAAACTTTCGAAAATTTCGCGGTTGATTACAGCTCACCAAAGTGCGATTATGGTAATATG
GCAGTGATGACTCTGCGACAGACGAAAGCCAAGAAACGCGTCAGGTTTGCAGATGAACACTCGGAGGAGGTCTCAAAAGCGCAAGAACAGCATGAAGAGC
GACGAGAGACGTCCACCGAAGATTCATTCGGCGAAGATTTGCCAGACCATCCTCACAAGACTGTACCAGCGGCATTTCCCAATGCGGAAGATGTTGACCC
GGTAGCGATACAGCGGGAACGACGCAGACGGATACTGGTGGCACAAGACGAGGAGCAGAAGTGGTTTAACATCAAGAAGGTGCTTCAGGGCCAAGCACAA
GAGCTGAGTTACAAAGAAGCTCGAGATGCCTGGAAATACGCTGACCGGTTCGTGTTATCAGAAGACGGCGTGCTACACTATCTTGGATTGAATCGTCGGT
ACGACCACGGTTGGCAAGAGGAGACCAAGCTGCGGCTTGTGGTACCGACAACGATGATTCAAGAGGTCTTGCAGAACTGTCACGACTCGCTGGAAGGAGG
ACGTCAAGGGGTGGTGAGAACGTTCCACCGCGTTAAGTCCGATTATTATTGGATCGGCTTGTACGCTGACGTGGAGAAGCATGTGAAGTCATGTCCAGAC
TGCAGCTCGAGTAAAAGCCGTCCACAGCTTCGTGGATACTCGCCTGGCAACGTACTAGCCGACGACCTTTCCAGATCGTCTCGATGGATTTTGTGATCCC
ACTACCGAAATCTCGCAGGGGCAACACGGCGTTGCTCCTATTTCAGTGCTCGTTCACGGGATTCGTTATTGCCAAGGCTATGTCAGATACGACTGCACTG
AGTGTTGCCCAAGTGCTCGAAGCATGTGTGTACCGACGGTTCGGAGCCCCATCATTAATACGGCATGACCGCGACCCACGCTTCATGAGCGAGGTGTTCC
AAGCGTTCGCAGAAATGATGCAGTCAAGATCACGGGCGACTTTGAGCTATCGGCCACAGGCTAATGGACAACAGGAACGCTCGGTGAAGTCGGTGATGGG
TTCCGTACGGGTGTACGCGGAAGACCCTTTACAGCAAGATTGGGATGAAATCGCAGAGAAGCTGGTGTTTGCTATTAATACTTCTCAAGACACTACAAGG
AAGGAAACGCCGTTCTACCTCGTTCACGGTTGGGATGCTCAGTCGACGTTGAGGGCAATGTCGTCATCACTCAAGCGAGGACTCGGCAAGTAGTCTGACG
CACTGGCGTGGCGGCGTGAGATCAATCGACAACATGAGGTCGCCCTCACTATGGCCAAGGATTGTCAGGCTGTAGAAAAGGAGCGAAGGGCTAAAAAGCA
TAATGATGCTCTGAGTCGACTGGAAAAAGCTGCTGTACCTCAACCAAGTGGAAACGAACACTCGGCGGATCCCCTAGAAGCTTCAGAAGAGATGGAAGAT
CCTGCAAGAGCCCCACCGAGAGCTCTTTTCGAGATTGGGAGCCGGGCGTGGTTGTACATGGAACGCGTCAAACCGGGCTTGACGAAGAAATTAGCTCACC
GATGGCATGGACCTTTTCGGATCAAGCGCAAGGTGGAAGAGTTTGCGTACGAGCTGAGACTGCCTGACCGAAGTGGGTATCGCTTTTACCCAGTAGTGCA
TGTGTCGAGACTCAAGGCTGTCAACGAATTCAACAGTCGACCGAACACTCGAATGGTACTTGACGCGACTAATGAAGTAAGACTCGACTTCGATGAGGAA
CTACTGCCTGAAGACAGCTGGGAACCAGATCAAGTTGCCGGTGAATATGAAGTCGAGGCCATCCTCGACGACAGAACGCCACTGACGTCGAGCACGGAGC
GTGCTGTACGCGAGTTCAAAGTCAAGTGGGTGGGCTATGAAGATACAACTTGGGACCCATCATCCAACTTGTCATGTGGAGGTCTGCTGTACGACTATTT
GCGAGCTAAGAAGAGCGAGAATCGGCTGCAGATGGCGCAAGTGGCGGACGAAGACTAGCGTGACTGGATCACGTTTGAACTGTCCACAGGGCGATGCAGC
CTGTGGTAACAGACGAAAAACGTTACTGCAACAACAAATTGTATATGCATTTGAAGAACACCATGAACATGATTACGCTGTGGAAGTGGATTAAGAATAA
GAAAACATGAATGCCGACCGGAGAACGACCACTGAAAACGAAGTCACGCGGGACACCTCAACAGTTAGCTGAGATGCTGGAGAACGTCGTGGAACGTGCA
GCGAGGGTTCAAATCGATTCCAAGTGCCTGGCCGCGGTGGCCAAGAGCCAACGAAGTCGAGTCACCACTCTCCTTCTCCTCTTCATCAGGAACCTGAGCC
TCGGCAGCTGGAGCTGAAGCCGGACCCTGCGAATCCTCGGTACCAGCTTCAACAGGAGCAGCAGCCAGAACGGGACGTGGAGTACCCGGTGGCGAGTCAA
ACAACGAGCGCCAGGTCGGAATAAGTTCAATTGAATCGAGAGACGGGTCAACGAT