Description :
From Genome Similarity Track
Location :
Scaffold_187:5381- 6555
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_187-fgenesh-gene-0.2Activator of 90 kDa heat shock protein ATPase
Pytul_var.sporangiiferummaker-pug3_contig_187-fgenesh-gene-0.10Liver stage antigen

Sequence
1174 bases(100 bases per row)
CGGGAACATGGTAAAGTTTCGTTGATTGGTTGCTTGTGTGGGTGTGCGTATTGAATGAGAACTGACCACGTGTATATGGCTGCTGTGCGTGAGTTTCTAG
GGAAGAAAAAGACAAGTCGGAGTGGGCGCGAGCGCGCTTGAAAGAGCGCATTCTGGACTCGTTCAGCTTTGTGGACGGGACACACAAGGTGTCGATCAAG
GCCAACTCGATCGTGAAATGCGACGGCGAGGCCAAGGTTCGTGGCGCATTTCTGTTGGAATTCTCTCTTCTCCTGTAGTATCCTTCACCATGTCAAACCT
CATGCTGCAGATCGTGTTCAGCCGCGGCAAGAAGCGCTGCGGGTATGACATTTCGCTCAAGTTTGAGTGGACGTCGACGCGCGCGGACGGCGAAGAAGAC
CCTGAGGGTGTGGACGAAGTCACGGGCCACGTGGAGGTCCACGACTTTGACGACACGAGCGGCGAGGACTACGAGATCAAGGTCACGACGGGGATGAGTC
GCAAGCACGACATGGACGCCAAAAAGTCGGTGCTCAAGTGGGAACCCGAGCTGCGCAAGATCCTCACGGCCTGGAAGGAGGAATTGCTGCAGCAGTAAAC
AATAAAAACGCAAATGGACTGATTTTTTTCCTTTCTTTACAACGGCTTTGCTATAAACATTGACATTTATCCTGTTCTGACGACTCTTAACGGTCGAGAT
GGAACGAGCTGTGCGACGACAGCGAGTCTTTGCGGAGACTGTGCAAGGATTCCTCCATGAGACTAGACAAATCCGCGATCGCAGACGATGGTCGACGGGG
GGTGCGTGGGGTACGAAGTGTGGGCGTGCGAGGGGTGCGAGGGGTAAGTGGAGGCGGGAAGATCATTCGGAACGACGTGTCCGAGTCCGGTTCCGTGGCG
TGAGAGGACGCCGACATCAAGAAATGCGCGCGTGTTGGCGTATTCGCGCCGACACTGGACGTTGTCGACGTCATTGCTAGTTTTGCCTTCCGCTTCCATT
TCACCGCCTAGTCATCAAATGTGAGTTGTGGGTCAAATCTTTACTGACCGTGTGTTCGACGTGAACGTACCGCATCCCGGATCTCGTCGATTTGTTTCTC
CAGTCGAGCGTTCTTGTCCTTGAGCTCCTCTTGCACTTTCTCCATCTCCATTTGCTACAACGACGAAGATAATC