Description :
From Genome Similarity Track
Location :
contig_22:538090- 539123
Transcript NameFunction/comments
g5969.t1KUF98829.1 hypothetical protein AM588_10011600 [Phytophthora nicotianae

Sequence
1033 bases(100 bases per row)
CGAGCCCATCATGATGAACATGCAGCACCCCGGCCAGTACTACGCGCCCCCGCCCATGACGGCGCAGATGCTGCACGTGGCCACCGACTACAACTCGGGC
GGCTCTGCTGGAGGCATCACGCCCTCCTCGCACGCCGGATCTAAGCGCTCGCGTGAGGAGCTCAACATGAAGGAGAAGAAGCGCATGTTCAAACTCAATG
ACCGCATCAACCAGCTCAAGGATCTTCTGGACGAGGCCGGCGTGCAGTCCAAGAAGAACAAGCAGTCCATCCTGGACAACACTTTCCACTACATCAGCAT
GCTGCGCAGCAACTTGCTCATCGCCAAGCAGAAGGCCGAGCGCGCCGAGAAGCAGGCTGACAACTTCCGCTCGCAAGCGAGCGCTGGCGGCCCAATGGAC
GCCGTCTTCAAGCGTTGCTTCGACCAGTCATCCACGCCTCGCCTCGTCGTGGACCTCAACATGCAGCTCCAGGCCGTCAACGCGTCCTTCCTGTCGCAGA
CCGGCCTGAGCGAGGACAGCCTCACGGACGTCAACACGCTGCGCGCCAGCCTCTGCCTGGACAACAACAAGCTCGACGCTGTCGTGCAGTCGGTCATCAG
CAGCATGAAGTCCATCAGCGCCATCGTGCAGGCGCAGGGTGTGGCCAACAACGTCGTGACGCTCACGCTCATGGCCTCGGTCCTCACGGACGACGACAAC
GTGGTGACCGCCGTCGAGTTCAGCCTCGTGCCGTTCGAGATCTCGTCCGACTTCTCGAGCCCGAACGCCGGCTACCAACGAGGTCAAGCAAGACCTGCAC
AAGGAGTCCAGCCCGTCGGGCGTGAGCGACCTCTCGGTGTAAGGCAGAAGCAGAGCGAGAGACCCACCGCATGTGTGAGATACCTAGTGCACGAGCGAAC
GAGGACAAGGTCCACTGCAGCGGCTTAGGAAGGAGAGGGATTGGGCCCTGTAGATAAAACTGTAACATATAACCTATTGTCGATCCAATTGTTGTTGACT
TGCATTATGCCGCCGCCGCTGCAGGAAGCGCCC