Description :
From Genome Similarity Track
Location :
Scaffold_192:53808- 55608
Transcript NameFunction/comments
g17479.t1RAW22593.1 hypothetical protein PC110_g20964 [Phytophthora cactorum

Sequence
1800 bases(100 bases per row)
GGATATATGCGTCTTGATAGGTAAACCTACTATGCGTCATATTGATAGCTGGAGATGGTAGGCAAACTAGCGGGCGTTCCGGGGTAATGAACAGCATTTT
CAATAATATTGATAGCCGCAAGCAGCGTTTACCCCATATATTGACGCGGATGGGGATATTTCTACTATGATATAGCGATGGGATTGACGAGCAATAAGGC
ATCCAAGTTCGCGTTAGTGAAGGCATCTCCATCGACCACGAAGGACCCGGTTCAACTACTATTTCCCCCGACATTTCTCTGCCGAGATACGGCTCTTATG
AGTGTGTTCGTGTACTTCTTCTTTAAGCGGTGATTCGACGTCTCAGCGCTGCGCCAACTCGCATTTTTGCCAGAAACTTACGCTGCTTCATCATAATCCT
GAACTCGTCATCATGGCATCGAATCGACATTCACTGTCATGCTCAACTTCAACTTACCGGTTTCCACACCGGTATTCGGTTCTACCTTCCCTCTTTCAGC
CAATCACAGCAACGCACCTCCCAAATTCGATTTCTGTCATTCCAAGAAGCGCCGTCTGATTCCATGGCCTTCGACCCGCGCTGCGTGGCCTTCGAGGGGC
GTCTGGGCGCCGACCGCCGCACCGCCGAGTACGTTGGGCGCGCCAGCCACGACGCAGATGCCGCATGCTTCCGCTCGGCGCTTCCGGCGGCCTCCAGCGC
GCGTTCTCCGACCCTGCGCGTCTTCTACTTCGAGACTCAGATTTTGGCCACTAATTCGGACCTTAATTCGCTACCTGCAAGACTTAATACCTTGAATTCG
TCGTCAACAATTCGGCGTCATGCTGCGCGGGATCAAGATGCCGCCGCTACAATCGCACGGGACTGGAGACGTCGAGCAGAACTGGAGGCCATGGACCTCG
AAGACATGCAGATCCCAAGTCTAAACCGAGCAGGCACAGAACCTGTGAATTTTAATTTTTCGCTGACACCTGATACTATACAGCACATGAGGTCGAGAAT
GGACCGACGCCGAGCGAGACGCAACAATGAGAGGAAAAAGTTCAACCACAAAGTGGCTGTCGGGTTCGTTGTGGACGAGCCCGAGCCGAAATTTCGAGGT
TCAGAGCACAATTTCGGGTCAATTTCCAGGTTCGGAGGCCAAATGGAGGCCAGGATGTCACGTCGAGCAGTGAAGCAGTTGATGCAAAGGATTCTGCCGG
ACGTGACAGCAAGCGGCGACTCGGACTCGTCTGAGGAGGAAGATGGGCAGGAGAAGAGCAGGGAGACGTATCCTGCTATTTTGCACCGAGATTTAGGACA
AGCGGCCAATTCGTTGGCGTACGTGGGGAAAACAGGTCGCGTGGTGTCCCATGGACGAGAGTTCTTGCGGTGTGAACGCTATGGAGCTGGAGATGTCGTG
GGCTGCGGAGTGCTGCTGGACACCAATACGTTTTTTTTTACGTTGAATGGCAACTTGATGGGAATGTTGCCAGCTAGAGATGTGTACGACCTGGACGATT
TTGGAGAAGTTGTCGGATCGGAAGAAGAAGAGAGTGACGAGGAGGAAGAGGAGGAGGAAGAAGGAGAGGACGCAGATGGCAGCAGGGGTGTGAGTATTCG
AGTGACCACTACTGACGACGTTGACATGGAAGATCTCGATGGTCAGCAGGATGAAGGGAAGGCTCTGTATCCGTGTGTAAGTCTGCATGGTGTTGGCGAG
TGCGTGCAAGCGCTATTTCAACCGAGTGAATTTAAATTTGATCTGTCCGGGTTCGAGAAGCAGATCCTGAAGGAGCACCAGCGAGCCTTGCTGGTTGAGC