Description :
From Genome Similarity Track
Location :
Scaffold_39:538047- 539793
Sequence
1746 bases(100 bases per row)
CATATTGCAGTAAATCAGTGCATTTGCTGTTTGCATGTGACGAGTCAAACCTTTAATTCTCAGTATACCTTTTTCTTTCGATGCATATCAGGCGTTCCTT
ATCGACGCACTTTACTAGTACTACTGCTACCGAGTGGGACCTCGTGAATGGAAATATGCGTGCAACGAAGGTAAAACGATCAAGCCATCTGCACCAAAGC
AGTACAGTAATCTGCCCAAGTAAGGAACGCCTGATATATATAAAGACGCAGAATATATAAATTGATGTTAAGTTGAGTATACTTTTCCAATGTACTGATT
TAGTTATTTCAAAATGAACTGAGGAGCAGCTTTACCTGCGAGTCCGGAATGATTCCAACAGTGGCGTATGGTCGAAGCACTAACCTTTGACCAGACATCC
TCGCACCACAACAGCGCTGTCATCTGGTCGACCTCGTAGGGATTATCTAGCCCTTCACCACGCCGGTCGCATCATTTTAAGTGAGGCGGAGACGCTTGGA
CGGTGTGGACTTCATGGGTGGAGTGGGACTTGTGGGGCGAGGTGCAAAAGTAAAAGTGCGAGTCTACCACTACGGTACATGTAGTTTGAAGTCTAGTAAG
ATCGCTTAATGCGCGCCATTTTTCAAACGAGGGTGGAGAGCTGATGATTGGCACTAGATTTTTCACCTTAGTACCTCAGTACCTTGCAGTACCTTGCACA
TCCCCCTATCGCCACATCGACTGGAAAATAATATTAAATATGTGAGGCTATTAGTTGTACACCCGTTCCTTATTCGGGCAGAATTCTGTAGTAGTACTCC
GCAAGCACTACTAATGTATTTTTCACGCGATGTTACCCCTTGGTCTCGACAACGGCACGAGGAGGAAGTCCCAGCGCCCTCCCGAGTTTGCTACTTCACT
ACGTCAGGTTGACAACAGGCTCTAGCCTGACGGATCAAGCTTGAATATATCTTTAAGCGCGAAGACGGTGTCCCTCGTCCCTACGTAGTGCAGCACTTCC
CACCCCATGTTGGGGCAATCGTTGGCTTTGTTGAAATAGCAGAGATTCTCGTAGGTGACACCGTTGCTTCCGCAGACCGCTTTATGGCCATTGTTAATGG
CGCACTGGTAGGGGCATTCTGCGAAGACTCCGGCGATCAGGAGCGAGGCGAGGACGGAGAACTTCATGGCTTCAGGCTTCGGGTGTGTGGTGGGAGGTCT
TCCGTATAGGAGGCAGTATAACTGTGGCCTGTTGCGTAAATAGCAAAGTGAGTAGGACGAGGGCTATTCCCCCGCTGAGCCGGCAGAGGATATTAGTACA
GCACAGCGAAAACCGATATCTTGATTTTTGTATATGATCATGGGGTTTGCTTCGCTGCGCTGCGCAAAGGCAGTCGCTGCGCTCCTGCGATAAAAAGATT
CTCTCACCTGGCGAGTACAGTGGTCGGCTCGCTGGAATGCTTGGCGCTGGGCCCGCCTCCGCAGATACCGCGCGGCCCTGCTTCGCGGGCGGGGTGCCGC
ACGGGTCTGCTATGGCTACGCGACCTCGCAAGTTGTGAGTCGCAACCGCTCGCCTCTGTTGGTCCTTTCTCTGGCCCATGCTGCACTAACGGAAATTACC
GAATAATACCCCGGGCACTATTTATTAGTACCCTCCCGTTTTCAAACTAATTCTGATAAATTACGTATATTATACAGTATTCCATGCATAAATATGCTTT
CGACAATAAGCCCACAAAATTATACTTGATATTTGTATTGAAGTAA