Description :
From Genome Similarity Track
Location :
Scaffold_562:5380- 8454
Transcript NameFunction/comments
Pytiw_DAOMBR242034fgenesh_masked-piw_contig_562-abinit-gene-0.23Histone-lysine N-methyltransferase
Pytiw_DAOMBR242034maker-piw_contig_562-snap-gene-0.10Conserved gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_562-snap-gene-0.7Gene of unknown function

Sequence
3074 bases(100 bases per row)
AGGCGCGCAAGGCCGAGCATCGACCGCCGCCGTACGGCAAGATCGGCAAGTGCGTGTTCGTGTCCAAGGCGCCGCCGGGCGCCGACCTGCCCGTGCACAA
GTGCAACTGCTTTGCCGAGACGAAAGTGGTGACAACGAAGCGCGAGACGCAGATCGCGAGTACCAAGGCGCTGCTCGCGAATGGCGGCAAGCGGCGGCTG
CGCGTGAAGGGTGACGCGGCGAAGAAGGCCGAGGAGGAGGCCAAGAAGAAAGTGGTGCTCTGCGGCGACAACTGCCACAACCGCATGCTTTTCATCAGCT
GCTCCGAGGACACGTGCTCGGCACCCGACCCGACCATGTGCAGCAACCGCGCGATCACGCGCAAGGAAGTCAAGTGCGTCCGTCGTGTTTTGCCTCCAGT
CTCGATCACGTGACACCTCCCGCGAGATCACAAACTAACTTTGTTGTCCGTTCTTTCATAACAGATCTCTGCGCGTGGAGTACATCCCAGGCCCAGGCTT
TGGCCTCGTGGCGAGCGAGCCCATCAGCAACAGCGACTTTGTGATCGAGTACGTCGGCGAAGTGATCGACGACGAGGAGTGCGAGCGCCGTATGATCCAG
TATCGCGACCGAGGCGAGGTGCGTTCATATCCATATGAAATTTGTTATGGATCTGATAAGATCTGTGGCTAAGCTGATGGCCCATGCGTGTATATATCAC
GCTTTAATAGACCCACTTCTACATGCTCGAGCTCGACAAGGACACGCTCATCGACGCGCGCTACCGGAGCAACGAGTCGCGCTTCATCAACCACAGCTGC
GACCCGAATTGCACCACCCAAAAATGGTATATCAATACCACTAGACACTTGTAAGTCATGCTGTTGTCGATACAGGGCTGACATTGTTGCTTGTGCGCTC
AGGAACGTCGACGGCGTGCTGCGCATCGGCATCTTTGCGCGCCGCAATATCCAGGAAGACGAGGAGATCACAATAGACTACAACTTTTCGCACTTTGGCG
AGGCCGTGGACTGCAAGTGCGGCACGTCGGCGTGCACAGGCAAGATCGGACGCAAGCTCTCGGCGACGAATCTGCTCAAGGGCGGCCCGCTCTCTGCCAA
GGCCAAGCAGGCGCAGCTCGAGGCGCAGGAGATCGTGCCACAAGACATCGAACGGCCGGTCCGCGTGACGTCGCTCGCACTGCTGAAGACAGCGCAGGTA
CCATATTTCGCTTTGGGAAAATGGTTCGTCCGACAATGTTGCTAACTTCACACAACTGTGGTTCTCTATCTCTCTGACTGCGTAGCTCGACACAGAGTGG
CTCCATCTCTATGGCTTCAACAAGAGACGGCTCTTCTTCAGCCACGCCAAGGCGGACAAGAAGATCAAGAGAGAGGACGGCAGTGCGGAGCTTGCTTCTG
CGTTGTCATCGTCGTCGAGTAGTCCCGTGTCAGAGTGGTCCTTGACCACCGAAGAGGACATTGACTCCCCTCTGGCAGCAGCAGCAACGCAGCGCCGGCA
ACTTCAGAAGAGCGACTGGTATTTCCGCGTGAAAGACGGGAAGCACCTGCCTGAAATGCGCAAGCTGCACAGCTACATCTGCGGCGGCAAGGCGGACTGG
TCCAAGGACCTCGCGGGGATCGCACGCGGCAAGAAGCCAGCGAGCATGAGCACGAAACACGCGGCCTCTGCGAGTCAACTGGAGACACTCAAGAAGAAGC
GCATGAGCTTGTTGGAAGCGCGCACGCGGCTTTATAGAGGTACGCCAGTTTGTTTTCTTGTGTGCTTCTAGCGCTTGCTTATCATATGCCCACTCGACAA
CCGATTGTCACTTTGTGCAGATTTGATTTCGTTCGCAAACGGTACGTCCAAGTGGAACGACCGTATCCCGTCGTCGCGCTCCATAGACGCCGAGCGGATC
TTCCGCTTCATCGAGCAGACGAAGAACGGCCATAGCTTCCACATCAAAGACGTGGTACGTCTTGCTGCTGTTGTTGTGGATTGGCGGACAATTTGACTTG
CAGAGCTGACGGATGTGCTATTTGTTGACCGGTACTAGAACGACCTGAACGAAGACGCATGCCACCGCTGCGGACTCAGCGGCGAGCTCATTTGCTGCGA
CGGATGCCCCGCTGCCTTCCACCTCTGGTGAGGTCCTTTCTCCTTCACGTCTGCACTCAATCTTCTGTCTAAAACCCCTCTGTATGCTTTCACTGTAGCT
GTACAAACCTGGCGATGATCCCGCCGGCGAACGTGAATTGGTTCTGCTCCGAGTGCACAAACCCACGCCAGCACGCCACCAGAGGACAGCCATCGACCGA
GGCCAGCGCCACCACAGGCGTGGACGGCATGGCTCGCCGCCAGCTGCGCACGCACGCGGCGCCGCTCGTGCCGAGCCTCAAGCGGCTTTTCCACTCGAAT
GCGCAGAAAGAGCTCGTGAAGAAGAAGCACCGAAAGCGCGCCAAGCCCGTGGATCGCTCCTACCGCTTGCTCGAGACCATGTCGCTGCCTGCTATCGCGG
ACACCGATGGCGAGTGAGTCGAGAGTGCCACGCATGCGCGCATGAAGTCGTCCCCCAAGCGTTGTCCAGAGCCCCCGCCTGTCCTGATACAAATAGTGCG
TGCACCTTAAAGCGAGAAGAAATGCCCTAACACAGATGTCCAAATGATACGTAAGCCGCTGCGTGTTGTCGTTATTGCTCGTACACTTTGGCTGGCACTG
GCCCCTCCACCTTGTCCTTGAGGAACTGCTCGCTGTCTTCTTTCGCTCGCTGTGTGCACATAGAAAACACGGTAATATAAACACCATAGTCAGGCTCTAT
ACAGGCAATGCGCCCACTAATTATCTGCTGCAGTCGTGCGCTCGTGTCGTACCTTGAGAGCCGTGACGAGCGCGGCGTACGGGCCGGAGGACTTGAGCGC
CGGCATTGGCACGCCGCCGTCCATCTTGCCCGAGTACGAGTGATTCTGGCGCTCTTCTGCGCTCGGCGCCTCATACTCGTTCGACGCCTCCGCTGCGCTC
GGGAAGCTCTCGAAAGCGTGCACCTGCTCGCCGCGGAAGCGGTACGTCGCCTTCATGCCACTCATGCTTTGCCT