Description :
From Genome Similarity Track
Location :
Scaffold_64:5380- 7870
Sequence
2490 bases(100 bases per row)
AAGTGATGATGACTTGATGCTTATAACAAGCTTAATGTGGCTACTATTCCTGCACAGACACCCATTCCTCGAAAGGATATACTTCAAAATATCATGGTTG
GTTGTACGATGTATAGTGCACTCGACTTGGTCGATGGATATCATCAATTGCTCATGCGAGCGAGTGATATTCCCCTTACAGCAGTGAGCACTCCGAGTGG
TATGCTATGGGAATGGCTGGTGATGTCTTAAGGGATGTCTTATGCCCCGGCTACATTTAATCGTCTCGTGGTGCAAATTTTCCGCCCACATAGGGAATAC
GCACAGACGTACTTTGATGACATTTTTGTCCATAGTCGTGCCGATCAGGTCAGTTAGATGTTGACAATCACATCGGTCATTTGCGAGCCGTGTTCGAGTA
CATGCGCACTAATAAATTGTACGCCAACGCGTCTAAATGTATTTTTGGTGCAGAGGAGATTGCTTTTCTAGGATGTTTCATTGGTAAGCGCGGCCCCAGA
GCGTATCACGCTAAGATCAAGGCTAAAGTGGACTGTCCTATTCCTTAGAATGGCCAAGCCACTTACTCAAAGGACTTGAGTAAGTGGCTTGGCCTTGCCA
ATTACTTACACAAATACAGTAATTTTATCGCTGATATGGCTCGGCCATTAACTGATCTCCTAAAGAAGGTCACGGATTGGCGCTGGGACAATACCCATGC
TGACGCATTTCAGGCAATTGAGGAGAGTCTCCTCCATGCTCTCATCTTGACGTTGCCCAATCCTGAGTATTCTTTTAGTGTTGTTTGCGATGCATCCGAT
TTTGCTATAGACAGCGCCCTGTTACAAACAGATGATGCAGGCCGCGAGCGAGTTATCGCATTTAAATCACGTCAGCTGAAAGCTGCTGAAAAGAACTATC
CAGTTCATGACAAAGAGCTACTTGCCATGAAGTATGCGCTCGTCAAATTTAGAGTCTATCTGCTTGGATCCAAGCCATTCGTCGTCTATAAGGATCATGC
GTCATTACGCACGGCGACACAGTCGCCTCACCACTCTCAGAGAATGGCTCGGTGGCTTTCCTTTTTGCGGAATATAACTTCAAGGTGAATTATAAGCCAG
TCAAACAAAATGTGTTGGCAGATGCCCTCTCTCACAGACCTGATTATGAGCTTGCTCGTGTCACGACTTTGTCGTCTCCTATTGTTAATTCGCGTGACAC
ATCTACGGGATTCTCAGTGTGTGGCATTATTTAATGTCCTTGGGAGTGAGGAATACCAGGAATCGGACAGTCAATTATCGGCAAGCTTGCGGGCCAGACT
ACATCAATATTGCATCGATAATTGTCTCTTGTGCTATCGCACAGATGTAGCGGATACCGCTCGCATTGTTGTACCTCAGGATGAGGATTTAAAGTATCTA
ATCCTCTTTGAGGCTCACGATACTTCCCTCAGTGGGCAGTTGGGCCAGGAAAAGACTTATGGCTCTGTGATTCAGCACTAATGGTGGCCCAAACTCTACA
AATGGGTGAGCACATACGCGCGTACATGCGAAACGTGCCAGCGGGTCAAACCATCAGCACATTCGGCTGCATCACTCGCCAGTTTAACTGTGCCCACGGG
GTGTTGGGATTCCATCAGTACGGATTTTGTGTTTGTTCTTCCCAAAGAATGTGACGGCAATACAGGAATTGTGGTCTTTGCTGACCGCAAGATGGCTCAC
TTGGCGGTGGTGCTGGATTCCATCGATGGCAATGGTACAGCTATGCTGTTTATCGATTGTGTGTTTCTTCAACACGGGTTGCCGCTGGCAATCATCTCTG
ATCAAGACCCTCGATTCACAGGAAAGTTTTGGATTTCCATCTTCAAGGTGCTTGGCAAGCGATTGGACATGTCCACAGCGAATCATCCGCAGACCGATGG
TCAAAATGAGCGAGTTAATCGCGTCATTGGCGATGTTCATCACAGTTTTTGTGCTGAGTCGCCTAATCCTTGAAGCTAGATGCTCCCTGTCATTGAGTTT
TCGTTGAACAACGCTGTTTATGCTTTGACCGGCTTTACTCCCTTCTATGTGAATAACCTCACGCACCACCGCGTTCCGCTCACGTTACCACTACGTGGTT
CTGGGCTTGGCGGGGGAAAGTCTTCTGATAATCTTGCTGAAATCAGCCTTACCACGATGTAGAAACAAGTGAGAGAGTTTCTCGCGACACGCTTTAGTGT
CTTACGACATGTGCGTGATGCAATAGCTGATAGCCAGGACAAACAAAAAGACCAAGCTGATGCTAAGGCAGAGGATGTATTTATTCTTATGAAGTCGGAG
ACCAAGTCTTATTAAATGCTAAAAACCTACCTACAAATGTAGTGTCTGCCGTTTTCAAGACGAAAATGCGTCCGCGCTTCATTGGGCCGTTTGCGGTCAT
AGCGGAGAAAGGCCTTGCCTCTACACTCAATCTCCCGCGCAAGTTGCGCACACACCCAGTCTTTTACGTTGGCTTGCTTAAGCCATATCA