Description :
From Genome Similarity Track
Location :
Scaffold_490:538- 20826
Transcript NameFunction/comments
Phymu_g10334hypothetical protein
Phymu_g10335hypothetical protein PHYSODRAFT_509250
Phymu_g10336hypothetical protein PHYSODRAFT_315971
Phymu_g10337hypothetical protein PHYSODRAFT_354826
Phymu_g10338hypothetical protein PHYSODRAFT_354827
Phymu_g10339hypothetical protein PHYSODRAFT_263017
Phymu_g10340tetratricopeptide repeat protein, putative

Sequence
20288 bases(100 bases per row)
ACAGGCCAAACATCATCCATGTGAACTTGACATACTCGGACGTGCTGACGTCGATCGCCTCCAACAAGAAGGTCGAGTTCACGTATGCCATCGCGTTCGA
GGACTGCTTCGACCGCTTCCTGGAGATTCTCCAGTGGAGAACGAGTTTTACAGAGCATGCTTTAAGAAAGTACTGTGATGATGAAGTATATGTTTTAAGA
AAGTAAATAAGTAGAAAAAGTAACGTGCTGATCGAGTGCCTTGAGCGCTTGAGTGATATAGCTCTTAAAACTGAGGCATTTATCGCGCATGCGCCACTTA
ATGGACTCTGGCCGAGAGAAGAGATAAGCGTAGAGAATGAGAGATACCCGACGTAAGTCACTTCAGTGGCAGCACGAGAAATGCATGCACGTACTAAggt
aagtacatgtagtacacgCACAGCGGGCTGGTGGTCTAGCTAAATCCTGTAGTAGTAGTGCACTTTAAGTACACTGTATTGCATTGTAAACGGTTACTGT
AGCGCCGTATATGCATGAAGCGTTTACCCGATCGCAGCGAGTGACGCGTCGCTCGCAACATGCTCTgtctctacatgtagtgacgacttcaacgtggtgC
GTTCGTCTTTCGCCTCCGACTCGGCGGCGCCGTCGCCTGGCGATTACCGGTTTGGATGGGCGCGTGGGTGGACCGGCGAATGTATGCACAGCCAGTGCAA
AATTTGCAGTGCAAACTGGTGCTGGGACTCCGGACTGCTGCAGTGCGGTGCCGGAACTTCTGGCCCAGAAGTTGAGATATCAACCCATCCACCCCGCTCG
CTTGCCAGAGCGGCTACATGCACTTCAGAATGTGCGTTGATCTCTTCAACCTGCACTGAGTGACAATTGCAATTTGTCGTCGTGGGTGGACCTAGAGGTC
TTATTCACCATAGCCGGGCAAGCAACCGAACTGCAACGACACACACGCACACTGTATAAAACATGTACCCCCGACACTTGCACGGTTGCGTGAAGTTTGC
GCCGCTGTAACTTACAGCCTGTGAACCTTACCACTTGTGGCGAGTTCGTCCAAGCAGCAATGATCTGACGTCTATGCTGCCGACGGCGTTTCGAGCGGGT
CGGAAAAGTTGGTCGTCGCGTTGCAGGCGCCGAATCTCGTGGATAAACAATTTTTGAGACGAATCTTGCTATCCCGTCGGATGACCGTGAGCGCGCACCA
CTTTTTTTCATCATGCAGCGCCAAAATTGGCAAGGCCGCCAGGAGGTTACATGTGATCGGCCGCCGACATGTGCCCCATTTTGTAGAGAACATTCTCGGC
GAAGAAGCTATTGTTCGGTTCGCTAACCGGACCGGTTAGGGTTGTGCATTTAGTAGGCGGTAATTGGCCTAAATCGAGAGCTTGCAACTCACAGCGATTG
GACAGATTGATTTTAAAAAGTGCTGATTGGGTTAAAATATCAAGCATGGGTAGAGAGCGGGCTTCACTGCCCAGAACCGGGCCAGTGCGGCAACCCCAAA
CTCCGGTTTTTGATCGGTTGACTTCGGTCATTAGAGAATTTGCGCTGTAGTGGAGAAGACGCCAACCCAGAAAAGCAGGTACGGATCAGAACCGCGTCGC
TGTTTGCTGTTGCACGCGCCGCCTCGCAGTCCACGGCGGACAACTAACGTGTGTGTGCTTCTTGTTCCTTCTTGTGTCTGCCTTGCCAGCTTGCAGTAGT
GCATTTGTCGCATTTATCCTATTGCCAAGAAGAGTGAGATAGTCGCTCACCCACCTCAAAACAAGTTGCAGAGCGAACCGCACACGCCGTttgtgctcga
gctcgtTTTGTTGTCCACTCTCTCCTCCATCACCACACGCAAAAGCACAGCACTTGTACCCTTTCTGTGTGTGCCACTTGCTGCCTTGTTGCGCTTGCGC
TCTCGCAGTTAGCTGGACAGAGGAACTGAGTTGTCATCCGGCCTATTGCCGCCCACACACGTCCACGCAGTAGGTAGTTTATTCTCGAACTACTGAAAGA
CGACACCgtggcgacgacagcagagATCCAGCAGAGCGAGTCCGATACAGTGACGGGAGTTGGCTAGTTACTGCAACGCACACAAACACTCAATTCAGTA
GCCGATAGCTCGCACAGTATTTGAAGAACGGAGGGAACCAAACCAATGACAGCGGAGGGCATGCGTGCCAAGCGACGAACCACTTACCAGAACATGCACG
AAATCGTCAAATTGGCCAAGAAATACTCACCCAAGCTGGTGAAGGGCTACAGTGCAGGAAATATCTCCgtggtggacaagaagagTTGGCTCGAAGTCTG
CGATCGCAAGCACCGGTATGTTTCGATGCGTCTCTTCAGGAGGGTGCGGTATTGTGTGCATTTACTAATTAATTGCTATTTTGATGAACAGATACGGCGC
AAACTTGCGAGCATATTACAAAGAATGGAAGCGTCAGCCGATGGAGCCCACGAAACCAAGCTTTTGGGAGTGGCTGGATGATGAATCGATTGAAGTCGCT
GGCGTACCGAGGACGAAGCTAGAGCGGGAGACTGTGTTGTACTGTGATACGGCTGCTGAACGTCAAAAGTTTGCGCTCTCGGTGCAGAACGGTGTAATTG
TACATGATGCCTCTCAAGAAATTGTGGAAACGGGACCCGATGGATGGATTTTTGTTTTACGCGATGGCGTTCTTTACGGCTCACAAAaagagacgaagaa
gatcccTCGAATCCACCATACGAGCTTCGTAGGCGGAGAGTGTGTGCAGACGGCTGGCATGATGGTGATCACGGACGGGGTTATTAAAACTATTTATCCC
CATAGTGGTCATTACCGACCGTCGgagtacgagctgctggtgctgctccgCTTTCTTGTGAACAATGGTGTAGACTTGAACGATGTAGATGTCGACGTCC
AACGAATCCAGAAAGTGTTTCGTGACTCAATCAACGGTGCActtgtgaagaagctggacaatGCGCACTTCTGGAATGCGTACCGTGTATGGTACTtttt
ggaggagaagcaTCTCGCGTGGAAGATTGGACTCTTTGACGAACTTGTAGAGACTGTCGGGCAAAAGACAGACATGCACGTGACACTTGAGCGATCGGAA
ATTCTGGAGGACAGCGTAATGGATGAGATCATTGACGAGGCCTCTGACATTTCGTTCAAGGATGGAGGATCTCATGCGTTGTCCCTCTTGCACCCCGCAT
ACGATGCACCAACTTTTGAAGATACCGCAAAGCAGCTAGCTACGTGTGAGTTACAGCCGTAAATCGCTTGGTCGAGGCCACCCGACAATATTTTTTGCCT
TTCAAGTCAAGACACCATCACCACCTCCGCACCTTGGTGGCAGCGGATACAACACACGTCAAGCAAAATATAATGTAATCTAGTGACCAGAGACACGGAG
GGACTCTCTCTAGTGTATTGGTAGTTAGCATATTGGTAGTAGCAACAGggacgaggaagcagaagaagtcATTATTTGCTCGCAGCACTCAAGCATCTAG
CGCGAATGCTGCGATGCGTTTGATTTATATTTTATGAATTTGAGTTTCACGAcagtttttcttttttttagTTGGTTACGGGGGTTTCCAGTGCCTGCAT
GTGCCGTCTAAATCTGTTTTGTATTGAGCAGGCGTTTACTCCAAAGGTGATGTCGGAACGAAGCTACATTGGTGCCGAAGGGGGAAATActggtgcagaa
ggagaagatttTGGTGCTCCGGTGCTCAGCCAAATTCACGTTTCATGCTACGTCACGGCTGCAAATCGGGCCACACCAGTATTTAAGGTCCAACCTCGGC
TTAACAATGTGCAAGTCGTGATGCCTGCTAGCGATTCGTCCTCAGGTGGTGGAGTAATTGCAGAGATGATGTCGACTATGTCTCCCAGTGGCAGTGGTGC
AGCCGAGTGGAATTTCGACTCAGTGTTTTCGTCAACTTCACCTTCACATGCTATCGATTTTTTCACTGAGATCACACTGCCAGCTTTACGAACTGCACGA
GATGGGATCAATTCAAATGTTGTTGTATGGGGAGTTCACCCTACTCAGAAATTCCGGTTGCTTTTTGGCAAAAGCGTGGCCAGGGGAGGCTTTGCCCCTC
AACCTGAAATGGCAGTGAACGACGTTGTCGAACTCTACGGTCAACTTGTGGGAATGCTCCACGCTTTCTTTTCTCATTTGGATATGGGGTCGCAGCAGCG
AGATAGCGAATCTTGGCGACTAGGAGTTAGCAGCTGGATCCTTGTGGACAACCAAGCAATTGACTTGTTGAAGCCTTCAACAGCGGGAACTATGGATATT
GGGCTGACATCTTCAGCCGAATCAGTAAGTTTTATTACGCTAGAAGCTCCATCCCTAGCTACAGCTTTTCGCATTGTGCAGACAGCGAAGACCAACCGCA
TTGTACGCAAACAGAACTCGGAGAGTGTCCACTTTTTCGTACGTTTGGCGTTATTTCACGGTGGCCAAGTCAGTACAGCGCACCTTGTTGATCTCGTTGA
CCAAAAAGACTTCCAGGATGATGTATTGATCCGAGAAAAACTAGCGCTGTATAACATTTTTCAAAGCCTGAGGCAACCTACATTTTCTCCAAGGCAGAAC
AGCAGCCATGCTTCAGATTCTGCCTTTGGAGCAGCTAGTACACTGAATTCTACAGGAAAAATGGTGTTGTCAAACTTTATGCGGCCGTTGCTGACCGCTA
ACGCCAAGACTTTCCTTTATGCAAATGTAATCGACTCGCGCGCCAGTTTACGGGAAAGTGTGCAAATGTTGAACGCTGTAGCCAGTCTTAAAGGGTTTGC
TTGTGTTTGTAAGCCACTTCGCGGGGTGCCATTCGAGAAGTTAGGTTTCCAGCCTACTATGAAAGAATCTGAGCCACAAGAATTTATCATCCTGCCAGAA
CAGAGCGGATATTGCATGGAAGGAAAAGCAATACCCGGGTTAAAGCGCTCGACATCATCACCACCTCTtggtgcttctccaccgctgTTATCTACGTCGA
ATTTTTAtcagacgatgaagaaacCAATAACGAAAGAGACTCCCCACGAGCCGGTTCTTGCTGCACGCGTTGAATCTGACGCTATGAGTTGGTTGGATGT
GTTTACGCAGCGAAAGCGAGATATCCTTGGTGGCTCTGTTGACAATGCAGATACGACAATATCTTCGCGTAAAATTTCTGAAAGAGCTACTGAAAGCTCA
GTATCATTTGACGGCAGAGTGAGGAACGAGCAGCTAGAGCAGAGCTCTGCCACAGCCGAAACGAGACCATCAATCACCAACTTGTACGAGCAATTGCGAG
AGTCTTTGGAAGATGTTAAAGAGATCGAGCTGGGTAGATCCAACAATTCACGAGCATCCTATTGCTCGCTTCATTCGTTGCCCCCTGATCACTCGATGAA
GGAGACCAATGACCCACTTCCAATTGTCGATCGCGATACCAATGATGGAGAAGTCCAACAGCTTGGATACAGCAGAAATACAATCGGAGGTATTGTACGC
CAGCAGAGTGAGCAGGAAGCGGATGACGAATTCTCTTCGTGGCCATTGTCCAATTATCTAGAATCTGCAGAGATACCAGGTCCACTAGCTGATTCTTCTG
TCCCCACGTCGCCACTCAAGCCCGATAGTATCACGTTAGAAgtgttgaagaaggcgggTATAGCTCCTTGTGTTTTAGAGCCTCCAAAAGTCGATGGCTT
GGATGTCAGGATGGTCCAAAAGgttcaagctgcagacgcaacTTTACTACGCAAAAACTACGATGCTCTGCTCTCAATCGTTCGTGAGCAACAGAAAGCt
aaagaagcagcagaagctcgtgcgACTGAGGCACTTCAGGATCAGGAAGAGATGCGTGCTGCGTTTGAAGTCCAAATTGAGAACATGAAGCTTGCTAATG
TTGGGCTTCGGAGCAAAGTACGCGCTCTCGAGAAGCGAACGTCGCTCCCTCAGGTGTTCGAGCAATACGAGCAGGAACTGCGCACACTCCAGGGCCAGAT
CCAGGAACTCCAAGCTCGGAATGTGGCGCTTGAACTCCGGGTGAGTTTAGTTGTCTTCTAGTGTACAAGTTAGTCATGAATGTGCTCATTTATTCGATAT
TGATGCAGTCGAGCGGAACGGATGGGAGTGGCCATGTCATTGTAGGCTCGAATGGATCATCAAcggagttcaagaagaagtatcagcaagttgcagagGT
AAAAAATGCTCTGGAACAAGAACTGATGGAGTaccgaagaagagaaaggTTTGTAGTTGGTATAAACCAAGGGCACGAGAAAACACTAATTTGAACGTGC
TGTCGTTGACTGCAGACATCATCAAGTCCACAGTCGACTGGCAGGTGAATCGACTCGGCGGGTGGGCCAGTTATCACGGTAGTTGTCTAACATCCAGAAG
CCTTTTTGGCGTGAAGGACACTCTGACAAATGTGTTTGCTTGATGTAATTAGAGACCTGAATAACAAGGAAGAAGATCTCGTTGCAACGCGACTGAGTAA
GCAGCGCATGAGCACAGAAATGAATCAAGCAATTGAGAAAGCGGACCAACTTCATCACGAAAACGAGAAGTTGTTGCAAGAGAAAGCAGCCACAActgaa
gagcttcttgccaCCAGGATGTATCTCGCCTCGCTTGAAAATGTACGTCCGTTTGGCTCGAAAACGATAAATTCGCAATTTTCTTGACCTGTTTGTATTt
caggagaagaagaaggcgtcgatcCTCAATCACTTCGTTGAAAAGCACGGCGATCGCATGAACAAACTGCGCAAGCATGGCCAATCGTGTCCGAAAGGCG
AAAATTGGCTTCGCGACCAGAACGCACGCGACTGCGAAGATAAACTATTGGCAACAGTCAAGCGGTCACTCCCGCAAGCTGTTCCGCTTTGTAACAAGAT
ATTACGACGTCTGGAGATGCAAGAATTGTCACTACGCGAGTTCTCCGAGCGTGAAGTGGACTTTATCAACCTCCTAGTTGATCTCGTGTCCGACCAACCT
ACAGTCTCCCTAAAGCAAATGATCGAGcaagagatgaagaagcttcaagcAAACTAACAACCAAAACGTGTTATAAAAGCAATAAAACGATAATTTGATG
TAGGCAAATgccaaggagatggagagcATCCACACTCCACGAGTCTGCATTATCTGCATATAGCCGTAGCGCAGAACGCGCTGGCACCTGCCATACTTAA
TGTGTCTTTCCTTCTCTCTACGATAACAATGCTCGAGATGGCAGCCGTTTGTCAACCACAAACGTAGCGACCAGGCACTTAGTCGACCGTGGCCATGGCA
ACGTCCTGCTCCGTGAACTTGCCCTTCTCGGTCTCGGACACAGCGCGGTTCTTGCgctccaggatcttcttgCGGTCCTTGTCaagcttgagcttggtgA
TGACCACCTTGGAGGCGTCAATGCCAATGGGCACCGAGGCGCCGTTGGCCTTCTCGCGCACCACACGCTCGACGTGGATGACGAACTTCTTGCGGTACAC
GGCGGTCACGCGGCCCTCACGGGACTTCTGCGAGCCACGCACGATCATGACCTCGTCCTCCTTACGGATAGGCAGGCTGCGGACCTGAAAGATAAATAAA
TCATGAGTCAAACGCCGCCTTTGACATACCTGGGGGTTGGTAGTAGGTGTAGCTGTCGTCCTGTAAATAGGAGTCGACACTTACGGTTCAGGCGATGCCA
TGAAGTGCCAGACTCTTGACGAGTTTCTGACATGGACTTACAGCGCTGAAAGTACCAGTGTACTAACTTACATTGTActtgttctgcagctccttggacA
GAGGCGCGCTCATGAGCACACGACGCTGGGTCGAGTGGGCGCCGAAGTGGGCCTTACGGCTTTTGCGGCGCGACGAGGACACGGTCGAGTTGAACTTCAC
TGTTGATTCACATCAGACACTCCGCGTAAGAAATTATTTATTCCAATACATTTTTTTGTAAGACCATAGCAAAGAGGACGTACTCTTGTTATCACGTAAG
AAAAGAGATACTGGACGCTTCGCTACAGTGTCGGGCGGTGGAGGCCTTGGAAGCCAACCAAGGTAGAGGTACGGTTAATTGTGACGGTTAAGGGTAGGGT
AAAGCTTTGACCGGTTAAAGTGGatttgtttgtttgttttgtgaaccttttttttctcaCACATTTGAAAATACGTTTGGTGGACGTTTAGGTGGACGTA
TTTTTTTAGGACATTGAGAGACGGCTTTTGTGTGGAGTCTGTTGACTGTTTCTGGCAGATCGGCTTGTGTTGCTCCGCGCTCTTGTAGGCActaccagct
tctgcttcaatGCGTGCTAGAGTGCAGAATTATTAGCTGTTTGGCATTGAAACGATAGAAAAAAGACACAAACTTACCTCCTGGATGAGAGTAGCAGGCT
CGGTAGCATTCTGCACACGTGAGTTCTTCAGTATGtcgccagcacttggtcttTCTGCTGCATTTGAATGCATCATCTGTGCGTTTAGAGCAGCGTGTTA
GCGACTAGTATAAATTACTATTCACAGGTTTAGTACCTGCTGAATTGTACTGcagagctgcttcgagtacTCTGGGCCAAAAGAAGGCAATTCTCCATCT
CGAAGGCCGTGCCATTCCTTTCCAGCTTCTGGCAATGGTGTTCCGGTGGTGATCTCGAGCATCATGATACCTGCATCACCATACAAAAAATCTGTTTGAG
TACTGTCACCAGAAAATTTACCCCAGTAGGCTCTAGGTTACCTAGACAGAAGATATCCGCCGAAGGAAGTCGGTCAGCGCTGGAaagcagctccttggcc
atATACTTCGCATCTCCTTCGAGTTCGCCTATTTTGCTCGATCCCTTAGTCACTTTTCCTGCCATCCCGAAGTCCCCAATCTTTAGCCGACCGTCTTCGG
TAATAAATATGTTGTCCGGCTTGATGTCCAGGTGAACGATGCCGTTCTCATGGAGTACTTTTAGCCCAGTTGCAACATCCTTCAGAATACCCCACAAGTA
GCTTTCTGGGAGTACCTCACGATTGCGCGTTGTAATAAAGTCTAACAACGTGCCGCCTTCGCACAGCTCCATttgcaagaagaaaaagcctGCAAACAAC
GTCGAAGATAGTGAGAAAGACCTTCTGTAGCAGTGGTGCCGACAACATTGAAGGGCAGGCATTACCATTTTCCTGCCAAGCTTGGTAATAGCGCACGATA
TTGTCAAAGTTATTCTCGGACGATGCCAAGCTTTCTAGGATGACAATTTCTTGGGCCCAGAGGTCTCTGTGGGATGAGTAAAGTTAAGAAAGATAGGCGG
CAATCAAATGCAGTTTAATGACCATCAGAGTAGCGTACCGTTCTCGATCATTTCGCACTGCTTGCTTCGACTTTTTGACCGCGAAAAGCGCTCCACCATT
TGGATCGCGGACCTATTCGTTACACAAGCTGGTCAATACGAACACTCATTCTGATTCAACTGAAAGTCAGTGAATATTTCACTGTACCTTGAACACTTCC
GCCGATACGCCTGCTCCGAGCCAGCGAATGACTTGCAAGTCCTCGAACGAAGAAACAAAGTGGTTCTATCCCAACAATTTACAGTTCAGTAAACTGAACT
TTCATGCACCTCAATCACCAAAGACACTTACTGGACAATCCACCACGCTTAGGCGCTTCAACACAACCTGTTTTAATGACAAACGCCGTTGAACATGCAC
CGGGCTTTTCATTGACAACGTCGCTCCAAGATTCTGGCTCAACAACGTCGCTGGACTCGCACACGGCGGTGACACCGATCTGCTGCACCTACCACCACAC
CCACATCAATATTTCCCACTAAACGCCGTTGTATCCGTACAGCTACGAACCTTCTGGCGAGCCCAATCCTCCTGTGAGACGTCGGGGTGCTCTGCTCCGA
ATTGGATCGCCGTTGCTGGATTCTACTGGGCGACAGTAACGCCCGTCGGCGATACGGCGGGTCCTGTCTACCATACACATCCATCCTCTCCATACGACGT
GTGTGATGGCGGAAGGTTCCCTCGATTGCCTTCGCTTTAGCGTCACAGGTACTTTGACTAGATGTGTCATCATCGTTATCATTGCTGGTACGGTTCTCGC
GCTGTTCGTCATCGTtctcgtcatcatcgtcgctACTCATGAAGCTCAGGGTCTTGTCAACACGTGGAGATGAGGCCTCCTCCATCGCGGCGTGCAGAGA
GCGCTTGCGCAtgggcgacggcgacgcGAAGTCCCGCGGCATTACTCTTGCTATAAAAATGGGTAATGCTCTGTATAGGCATATTTAAGACATACGTATT
TTTGGACCAATCACAATACTGCAAAAAACTTTCTGATGCTATTTATagatgcagaagctgagcCCCTGAGCTCATCAGTCTGAAGCTGTTCGGAGGCGTC
GAGATGCTGGGCAAGATCTCGCAATGGCTGGCCACGCGGCACGAGGATAAGGGCGACGTcagcgacgccttcgtgcagcagcgttaCGACGCGCTGGTAG
GTGgaatggagctgctgcattgaaAGGGACGGGGAAATCTGAGAATCTGATGCACTTGAACTTAGTCTCGATTGAAGAACGCGACGCTGGCTGTACTACG
CAAGGAAACCGCAGCAGAATTAAGTGAGCATCAGCCGCTTATTGGCCAGGAGGAAGgtgtggcgctggtgtcgcTACCCcgtgagcagcgccagcaatTA
ACAGATTGCGACCCTTGTGTCGGAGAGCTTTGTACGTTGCAGTAGAAGAAAGTCTAGTAAATGTTGCGGTTTTAAAGTTTTGGCTTTATTGATCAGGTGC
GGCTTTGGAGGAGTGTTTGGTCCTGGGACTCAAGTCACGTAGCGATGAGGACCAACCGTCTTGGTGGCACGTGCTGTATGCCAGTACGCTTATTGTGGAC
GAGCCGACGCTAGTGCAAAGCGTGTTATCTGCTGCATTTTTAGCGGAGGTTGGTTGGTGCAGTTTTGAACGAGAAGGTCTTTGGTTACGTTTTATTTACG
CTTGTGCTGTGATCTTGACAGACCGATGTAGGAAAATCACGCTGCTGGCTTAAGATTGCGCTGAACAACCACACGATTGAATCAAGCATAATGGTAAGAA
TGTCAGTTTGTGCTTGCTTGCTTGGTGTGTTGGCTGCTCACAGTCCGTGGTTTGTGATCTAGATGATCTTTTCCATGGCGTGTGAGCACCTCATCCGCAA
TAACTACGAGGAGTGGTCACTTGTTCGCTGTTCTGAAGGACTTGGTTTGTTTCTTGAGCTGGTTATCGCGCTTCGCGAAGTGCACTTTGCTATTGAAGTC
AACGGTGACCCATTCCACTTGCCGGAACCCGTGGAATTGGCTGACGTAGCAGAACCTGTTACTGAGAGCAATACTGGGGAAATGGTCTCCACAATTACGG
ATGCTGATATCGCTGCAGCGGTAGGGGTGTCACCTTCTAGAGCTGGATCATTATTACCACTTCAAGAGATCGAGCCTGTGCTGATAGAGCTTGAGGACGC
AAAAGATCTGGAAATCCAAGGTGCAGTGGTGgttgcagttggagaagaggaagaagtgaTCCAGTTACCTTCGGCTTTATTTCCGCACCGCCTCAAAGGC
ATTAAACCGTGGCAGTACGTGTTCGGGGTCAGTCTGGCCTCGCTTTCGAAAAACCCGTACCACAGTCGCTACGCTCTGATTGATCCTTTACTAGCACTTC
CGAACATTGTGGACGATTGTGTTGCAATTCTAAGGCAGAACCCGGATACCCCACGGTTATTTCGAACTACAGTGCTGAGCATTCGTCTGAATCAACTCCG
AGAGATTGTGGAGACTGAGGGCTCGGTACCGAAAGACCTGGATCCGCAATGTGCAGGTGCACTGCTCTTGGATTTTCTGAAGAACTTACCAGATTCTTTG
GTGACAGACGACAAATATGACGCgttcgtggctgctggacaacTGCGTGATGAGGATGCCAGTGTGCGCAATATCACGTGCTTGGTGAACGATCTACCTG
CCCATTGCCAAATTGTGCTGAAGAGGGTGATGAATCTTATGAACTTCCTGCAACAGCCGGAGCATTCGGAACAGAACGGAGTGGATGTTTTGACAGCGTC
TACTGTTCTAGCTCCTGTCATTGCCTTCAGGAAAGATGCAGGAAGTGGATTACCATCTGAACGTCCTCGTGGTAGGACCCACTCTCAGTATCAAGATGTA
AGGTATGCAGCAGTGGGCGCCCAAGTAGTGGAGCGGATGATCCAGCACTATGCAAGCATTTTCCACGATGTGCGTGTGCAGGTTGTTGATGCTCTCGAGC
GTTTGGAGGCGAAAAAAGAAGCCCTTCGCATGGTTTCGCATCAGATGAAACTCCAACCACAGATGAACTTTTTATCGGACAGACAGCAAGTTAACGAGAT
ATCTCGACTGTTCCGTGGGCATCTGGAAGGAGGTGATATCGCCTCTCAATCTATTCAAAATGACTCCGCTACTGTAGAGTGCCCAAAGTCTGACCTGGCT
GGCCTGGATAATGACGCTCAGACTACCGCTGCTGTTAATTTGGAGCTGGATTTGCTGGGGCCAACAGTTGCGACGCCCCCAACCAGCGCTACCAGCAGTG
GAGCATCTTCTCCCACGACCAGCGAAACAACAGAGCAGGATCTCGTGAGCGTTTGGGAACAATTCGGCTTCAACAAACCAAATGTATTGGGAAATTTTGA
TAAAGGAGGCGTACTGATGCTGCGAGCCATTTTGTACTGGCTAAAGAGCGACCCAGATGCACTACCGTTGCTAAAGATGCGGGCTCTGCCGTCCGAGTTG
CCATCTTATGATGCAGGGCTGGTGACATCATCTATTTGCGAGGcgttggtgaagctgctgaagttaTTGTACGTATACTGCTACTTTTTATTATGGTTCT
GGCATCGGCATGACGCTAACAAACCCTATTTTATCTGACCTACAGCTTAAACCCCAAACACCCTGAAATTGACATTGTGGCAATGTCGCTAGAGCCGTTC
TGGGAGCTTTTTGATGAAGACATGTACTTCAACAAACTTTTCATGTTCATGGTCCAGGTATTCGACCAACTCTGGAGTGAACTTGATCCAAAGGCGGCGT
CTTTTACCCGAGTAATAACTGAGACAGAGGGGATCATGAATGaattgctgaagaaggcccCAGTTACTGTGAACGACCTGCGAGTGGAATGGGAACAGAT
AAGGGCGCGTCACATTGaggaaagtgaagaagaagaggaaatgGAGGAGCAAAGCGAGCTcgtggaagatgaagcgcttcgCGTTGCCGCTCTCTCTGAT
CCGTCGCTTTTGTCGCCTCCATTGCGCtactcgaagaagaaacctTCTTTCGACTTCAAACCGGACGATtacaagtggaagctgaTGGATACGTCGAGCA
TTCTGACACTAGACCATATCGCTTACATTGACCATGCGCTGCCGATCACAAGTCAACTCTGCCGTTGGTTTCGAATCTACAGCGTCGAGGCCAATGGATC
TTCATTGGAGACACTGCTGATTCTAGCAAAGAAACAGAGCCCGACGCTTTTGGTAGTCAAGGATGCCGAGGGAAACGTGTTTGGCGGCTTCGCGTCGGAC
GAATGGCATCGAGCATTCCACTATTACGGAACTGGCGAATCGTTTTTATTTTCCTTTGCGAACCAAAATGCTGCGGGTGGGTTTGTGAAGTACCAATGGA
GCCGCAAGAACAGTTATTTCATGCTGTGCTCGGACGAGTCATTGATTATGGGTGGTGGGGGCAACTTCGGCTTGTTCTTGGTGAGTCAGGCACATTCCTT
GAAATTGGTGCAGTAGTTTTCTTTCTAACAGTTTTTGTTTGACCTTTCAGGATAGCGATTTATCGAGAGGGTCAACTGGTGCGTGCGAGACGTTCAACTC
GCCTCCTTTAACTACTTCGCAAGAGTTTTCTTGCGTCCAAGTCGAGCTCTGGGGATTCACAACAGGAGACAAGCCTACTGGGATGGGTGAGAGACACAGG
AGGAGCGTATTGGACTAGCAGCTAGGAACGGTGCAATCTGGACATTATCCGCTTAAAAAACGATAGCGGCATATTTTATTTACTCGGATCTGGGAGCTCG
ATAGCACATGTAGTGGGACGGCGGCACCCGAACGCTGGTGACTTGGGTTGCGTACAGTAGGTAAATGTATTCTGTGAAAAAAAAGTAGTAAAACATCGCC
TACTCATTGCAAGTTGAGGTCGCCATTCGGTATCAATTGGTTGtccagctctgcttcaaACCTCCGGAATggagcttcaacagcttcacgcTGCAAAAAA
ATCAAGAGTGACATAGCAGGTCAGATATGAGCCGTTGCGCGTCTGGAAAAACATTCAACGAACCTCTTCGGCCGTGGGTGTTGCACTCGCCTGCAACTGC
GGCTGCaattgctccagctcgtgctcgaaCACTTCCGAGAACCGCTGCAGAATCCGCTGTAGAAACACTTTGAGTGCGGCGCAAGCTGCATCGGAAGTTC
GGTCGTGGAATAAAACTGCCTGGACATTCTCATTTTGGAGCGAGATCATGATGAGGCCGCCAGCTGAGGTCTGTGCAGTATAAAAATTAATATCGGTGAG
GTGTACGATAATTGAAGAAATTCTGCTCTATCGAGAACCTACGGGCATTGGGCTGCTGCCGGATCGATCTTTCTTGTCAGTTCTGCTTGGATCGAAATGT
ACCTGCACAACCTCTGACGACGACATACAGTTAGAGAGCACATATAATAACCCATATTAAAATGGTCTAATGCACACCTCCGCCGTCGATCTCACGCGCG
AACTGCGTGAAGGACATGACGAGCGCGTCCACACCTTCCGCGTGCGCCTGTGGGTTCCATTTCCACTGGTGTGTAAACAGACACACGCCTGattgctggt
gcagcacctTGACCATGCGCAGCTCaccgagcagcacgttcaTTGTGGCAAATCGATGAGTGTGGAATAGGCATTAACGTGACACTTTAGTGGCATCACA
ACTGCTCTTTTATTGTAATCACGACTTCCCAATTGCAAACATGAGTGGCATGAAGGCGACGTATAAGTTCCACGGCGAGGTGGTGCACTCGTTCGAGAGC
TTCCCCAGCGCCTCTGACGCCTCCAACGAGTATGCACCGCCGCCTGGAGAGGAACAGCTTAACCACTCGTACTCGGGAAAGATGGACGGAGGAAACCCCA
TGCCGGAACTCAAATCTACGGGCCCCTACGCTGCACTCGTCACCTCCATCAAGGTGCGATCATTAAACAATAACCGAATATTATAGCGTGGCGAATGTTC
TAACTAATTGTGACTTTGATGCAGCGAGCTAAGGAGGATAGTGAGGCGTTCCTGAAGGACCGCGTGGAAGGCCCCGTGCCAGCCAAACTCTACAACCAAT
AAACACATTTGCTTCCTTTTCAACAAAACAAGAGTATTACTTTCATCATTTTCTAGGTGAAGCGCTTAACCACAAGGCCAAACGACAGTAGTGTGCAAGT
ATCAACAGCTCTGGGAAATGTACGCGACCACCCGATTGAAAATAGGTCGCTTTGAATCCACCTATTTCTCAGATTCGctctcgtcgctctcgttccACAC
GGGTAATGGCatgtgctccagctcgcggTAGGAGCGGTCTGTCGCTTTATGCCGCTTCTTGTAGCGGCGCTTGGTGCGAGTCACTGGAGCATGTAACATC
TTCATGAGACTGGGAACCTGGTGTGCCGCGTGCGTGCGTAGGTGGCGGCCGGTGTAGTCGGTTTGTGTGGTGCGGCCTCTGCTCCTTGTGCCTCTTGCAG
CGACGATGTCGCTTTCAGACGTTTCCGAAGCTTTCTGAAGATGTTTGGGGTTTGTACATTCAGTGCAAAACCATGGGATTCCATCAGGAGGGACCATGAC
AAGGTTTGTACAATTGAGATGGAAGGCAGCAGGGCAGCCGTCACAGCAAATTAGTTCGCCGGCTAGGCCGCAGCGAAAACAGGCGTCTTCGTTTAAGTCA
TTCTGCATAGAAAATCAACAACAGTTAGAGATCTAGCCTAGCACAGAGCAGTAACATTAAGGAACTTACCTGATCAGTGTTGACGAAAATCTGCTTGCCG
TTCACGCGATCAATGAGGCGATGAATACGGTCGGGGTCAATAGTACTGGACGATGGGACGCGCTTGTTCCACTTCGACTTGCCATTTGCAAAAGCTCCAA
GCTCGTCAATAACCCGTGCTCGTGCCTCCGAGAGGCTCAATCGTGTGCGGGTAAGCTTCGTTCCATGAACAGTGCGCTTGGGTTGGGTCGATACAGGCAC
CATCTTTTTAGGACGACTACGCTTCTTCGGCGGACGACCTGGGCCTCTTTTTTTGACTGGTGAAGGGGAATCAGCCACTTGAGCGAACCCTGCTGGAAGC
TCTCCCGTAAAGTCTGCCGTCCAATCTGACTTGCCTCCGCAGATATAGCTGTGTAGTGCTCTCATTTCAGGCAGGTGCTCGCCCGCTATGACCTTTTCAT
ACCAGTTGCTTTTGCGTGTCTTCTTTTCGATCGGGTTGTTCTGTGCACCTTGGGGTGGTGTGAGAGATACGTCCTCCTCGGTTGTCATTGAGCACTCGGA
GGCTGGTCTACTTGATGGTGGACTACGACGAGGCTCCACATTGTCATCCTTCTTAGCGGGGTGGCGCTGTCGATGGCTGAGGAACAATCGACGATTCTTG
AACCCGTAATAATCCAACCAGCTGTCATCCATCTGAGAACTCTTAAGCAGCGCCAGTGAAGACAAGTGGACAGGTCGTTTAAGCTCGGGCggctcctcgt
ccacagGCACCTGCCTTTTAGACTTCGCAGTGCCCACCACTCGAGGATTGAACGACGGCATTTTCGAACGCTTGAGACCAATTTTTCCTGTACACGCAGT
GGATCCACATTTGCaatcagcagcttcgccgaAATGCGAGAAGTTGTAGTCGATGGTGATCTCCTCGTTAAAAGCGATGTTGCGGCGGGCAAAAATGCCG
ATGCGCTGCATTCCATCCACGTTCCACTTCTGGGTCACGCTGTTGGGATCGCAACTATGATTGATGAAACGGGAATCGTTACTGCGGTACTTCGCGTCGA
TGACAatgttcttctccagctccatcatgTAAAAGTTAACCTAGCGCACCATCCCAATGTCAGTAACGCTCTCCCCAACGCAATCCCCATACAAGCTTAC
CTCGCCGTTATCCCTGTACTTGATCAGCCTGCGTTCGCACTCCTCATCATCAATGACTTCCCCGACGTATTCAATGATGAACTCTCCGGCCATGATCTTG
TCGCTGGCAACGAGTCCAAACCCCGGCCCTGGGATATACTCCACTCTCACTGACTTGAGCTCCCTCCTCTTAATGGCGCGATTGCTGCACAGACTCGGGT
CGGGGGCAGAGCAAATTTCATCCGAGCAACTGATGAACATCATGCGGTTGAAACACCCTTCTCCGCAGTAAGACCTGTCATCCGCCTCTTCATGTTCTTT
TCCCACATCGACACCCttgtcttccagctccttttgAGCTTTGGCACTGGCCATCATTGTCGTACGCTTGGTCATGGACTTGTGGGTCTCCTCACAGCAC
GTGCATTTGTGCACGGGGAAGTCAGCAATGGGCATCTTAGTGGATACATAGACGCACCGACTGATCCTGCCGAATGGCGGCGGGCGACGCACCAATTGGC
GCTCCTCGATACTCTTGATTTCTGCCTCTTTGAAGGGCAATTCAAACTCCTCAACGTGCTTCTCGGTACGAGATTTGGCTGCACCACGACGTTTAACAAG
CGGCGGTGGTGGGGGCGGCAGATTTCGCGCATCTTCCTCCAGGAGTTTCACAAAGCTCACCGTCTCCGGGTCCACAGCGAGCAATTGAGTCGTCTCGGGC
TTAGTTGCGGGCTCATTGGCGATAACCACGGACTTGTTCACTTTGGGTGGACGACCAGGACCGCGCTTGACCCTCTTGGGCGAGTCGTGGGAGGCCACAG
CCTCAAGTTTGCGCTTCCTGGGCCGCCCAACCTTCTTCGGTGGCATTATGTACAGCTAGCTAGCCACACGAGCAGGTCAGAGGATGATTGGCGAGCAAAA
CCGAAATTTGAGTCCAAAGTTTCGCGCCATCAGAtatgattggttgaaaacCGTTGATAGAGAGTTTCTATTGGATAAAAACGTAATGGCTACATCTGCA
ACATTGCGTGCGTCAGCATGTCATTGTGACGAGCTAGAGCTGAGCTTCCCGGTTGTTGACCTCGTTCAGCGCGGCTGCAAGCGTCTTCACGGCCTCAAGT
TCAGCGAAGTCCAcctgcgccttcttcagAACGCCGCGGATGTACAGTCGGCACGAgtacagcgccttcttggtgccCTCAGCCAGGTAGTCTTCGGCCA
GTCGAGTGGTGGCCGCGCACAGATCCTCTaccttctgctgctcccgCTCCCAACCAGCCACTTGCAACGCGCGACATTGCTTCAGACGGCAGTCACGCGC
CTTGTCGGAGCGGCCCTCGACACCGTCGTTGAAGTGCGCATACACCTGCCACACCTTGGCATCGTTCGTTACGATGGACGTCACGCGGCCAAAGAGCATC
GCCAGTTGCTTCTTGTAGTGCGAATCGGACCGCGGTGGTGTTGAATCAGCGGCCGTAGTTGCCTCATCGAGCTCAGCTaagtcttcatcgtcgtccagtt
GGTTACcctcatcctcttcatcctcctcaTCAGCCGTCGGGATGTCACCCGCCTCGGCGTCGGCctcctgctgcatcttcttcagcgactCAGGGTACAC
GATTGCCTCCACGAGCcacgccagcagctcactgtCCACTGGGCGTTTGTGCTTGGCTCGCATAtccaggagctggtgcatAGCGTACATGGCCTCACCA
TAgcgcttcgtctccatcgcgCACAGTGCGTAGTTCTCCCACATCTGCCACATGTgacgcttctgcttcagagcttcttccagcaccgcGAAGGCCTCCG
CGTACCGCTGGTTGTGAAGATGAATAGAGCCCAAGTTGCCCCAGGCCTCGCCATTATCAGGTTCAAGCTGTACCACACGTGTAAATGCACGCATGGCCAA
TGCCCAGCGATTAACGCGCATCGCAATCGAGCCCAGCGTGAACCAAGCGCCTGTGTGCATGGGACCGACCCGCACAGCATCCTCATAATGGGGAATTGCC
GCGTCGTAGTCGCCCTTGTCGAAGTAAAAGCGCCCGAGAGAACGCTTCGCGCGAGCGAACCTCTGCTTCGACAGTGTCCAGGACGTCTCGTAATGTGAAG
GCTCCTGGGCCAGGTCTCCGAGCGTGACCCACATGAACGGAGTGGGGGCGATCTCCAAGCGCTCGCGCACAAGCTTCTCGGCGCGCATCGGCTTGTCCAG
AAGCTGGTAGCACTTGACGACGTCATCCCACATTTCTAGCTCTTCGCAGATTTCAACAGCACTGCCAAGAACGCCGAGCTTGAAGTAGCGCTCAGCCAAG
TCGCGCTTCAGCGCATATCGTGGAGGGAAGGCCAACGAGTACACAAACTGCATGCGTTCGCGAGCAGGTGCAGAATCTGCGATAGATTCCAAAGTATTCT
GCGTGATCGTTAGACGCGTGGTGTGTTGATCTACCAGCGCTTGCATCTGCAAGACAGCGCGCTCGCGACGCTTGGAACTCTCGCACTCCAGCCACGCACG
CTCTAGCAGCGCCGTGGAGTACACCATCCAGTTGTTGGGGTTCTCTAGCACACGTGTAACATACGGCATCATCTCCTCACGGGTGAGACCATCGTTGGCA
TTGCTGTTCTTGACATCCAGACACAGCCCCAACAGCACAATTTGGTCGACGATCTGCAAATTGCCCTGCTCTGTGAGCTTACGGTCTTCGAATGCGATAC
TTTCGAGCAGGTAGTTGTCCTGATCCACTTGGTCTAAGTTCACATTGCGATACGAAGCCTCGCCTTCTTGCACAAGTCTCTGGATCTGTTCCTCCTCAGC
TGAGAGGCCATCGGCTGGCGGAGCGGAGCTGTCCATTTCACcttccgtcgtcgtctgcttgCCACCAAAGTCAACGTGAGTTGACTCAGCCACCGCTGTA
GCGTAGACGGAGGCTTCTGCGTCCTCACTCGCAGGTTCCTTCACCGATGCCGCGAGCAACACCATCTGAGCCAGACTCTTCTGCTGGAATTTGGTACGTT
TGCCCATGGATCCGCTGAGCTGCACACTCACGCCAGAGATCTCCTTGGCGCGCGCAAAGGTAGACTTGCCGTGCTTGTTCTTGTCGAA