Description :
From Genome Similarity Track
Location :
Scaffold_134:53797- 54930
Transcript NameFunction/comments
Pytap_DAOMBR444snap-pag1_scaffold_134-abinit-gene-0.74LMBR1 domain-containing protein 2 homolog A

Sequence
1133 bases(100 bases per row)
CCACGCCATcgTGAACTcTCCCCAGAGTACACAAACcGATTCAATCGCCGTCACCACGCTCCCAAAGCCCCACAGCACAGGCAAGACCACTCGCTGTACA
TGCGACTGCGTAACACTTGCGAAGGACTGCGCcTGACTTAGGATTCCgaCAGTGGAGTAGATGCCCACGGGTGGCAAAGCCGAGTTGCTTCTTGTCTGTG
TCTGGAGGGCCTCGGCCGTGATACAGACTTCCTGCCAAGCCTGTTCGGAGCCGCGAAGATCCGCTTGTGCGGCTTTTACTCGACGATGCAGTTCCACGAC
CTCACCATAAGTGGGAGGTGCCATaCTGACTGTTGATGTGGATAGCATCGGACTTTTCGTtGATCGAGATGCCATTATAGAAGTCTTCTTGAACATTCGG
CCATGCTCGGTATCAGCGTCTTCAGCCTCGACCAATGCCATCACGGCCGTCAGCCCAGCCTTCACGTCTTGCATGTCGGACGTCAAGACAATCGAAGCGG
CTTCTGCATGCAGCATCCGATCGTAGCAACGACGGACATCTCCAAGCACATCCTGGTAGAGGAAGATCGACTCCATGCGCTCGTTATGAACCTGAGTGGC
TCGAAAGTACAGAGCTCGCAAGCGCGCATCCGGGTCTCGTAGTAGCCACAGTGATCGAGGAATGTCGACGAGGCCGTAGCCCAGCAGGATGATGAGCCAC
ACGACACCGTAGGTGTTGGCAGTCGCCATCGCAAGACCGAGCAATCCTTGGACGGTGAAATGGCCGACGAGAAGCAAGTAAACGATGATCGCTGTGCTAA
cAGTAGCGACAaTGGTCCAGTGGAAGATCATTTtCTTCATCGAACTGACAAGGCGGCGCTTGAGCTCAAACTCTCCATTCTGGGTGAacTCGACGAGGAG
AGGAAGTAGAAGCCAGCTCAGCACAAACGTGAGCCAGTACagCGCTTGCCAGACGTAGACAAAGTCcaTCCGATCGCGTTCtACGTCTTCTCCTTCGTCA
TCTTCGCCATCAGCATCAGTCGGCGCAGAGAAGAGAGCTCCGTGGCGAGCGATGTCAATGGGAAGTAGCAACAGCCCAAGAAAGCCCAGAGTCCAGCTGA
CGAAGACaccaacgacgcccactgcagacacat