Description :
From Genome Similarity Track
Location :
Scaffold_571:5378- 7540
Sequence
2162 bases(100 bases per row)
CCAGGCGCTTTACAATCTATATCACCCCGCATCTGCTGTATTACTAAGTTTGAGTCACCACATATAATGACTCGCCCCCTAGTTTGGCCACCCAGCAGGT
CGAAACTCAGTAATAGACCACGATATTCAGCTGCATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNATCTTTCCCTTCCTCACATCTCCTCTCTCCAGTGTCCAATCGGATAGCGGCGCGGTCCACCTTCCTAGTCTTTCGTTGAGGCCGGGGGATCGAACTA
GCCAGGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNCTACGATCACCGGAAGTCGATCGGGGTCGTAATGTTTGAGTATTGGGGTAGTAGCGATCTTGGACTTCAACA
GAGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGTGATCCTAGGACCTTAGGATTAGCTTCCA
GCCTGGCCAATGATACCTGGTGACCCAGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGGTAGCATCCTTACCCGCGCCGATCTTGAGA
TATCTATATAAAGTGTCATCAATCAAACGCTGATATTCTGTGGAGTGTTCTTCAGTCCAAAAGGCGTCCTNNNNNNNNNNCCATGACGCAGCTGGGATAA
ATATACCATCAACATAAGATCTTCTGCACTGACTGAGTCTAGACGGTTTCTGGTTCTTCAGTGAACACATCGGTCAACCTAGAGGAATTNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACCATCAAACACTGTCAATTTTTAAAAAGTTCCAATTGATTATTA
GCTGATCCACTCGTCGATAGCCGATACATAGTCGGNNNNNNNNNNCTTTTAATGATCACGGCTATTGGTACAGCCCACGGCGATGTCGAGGTAGAATAAA
AAAAATATTAGCCGACAACAGACCTTTTATCAGATCGCTCAACTTCTCACGAAATTTTTTGGCGCAAACGGTCACACGCGCTGCGCGATCGGCCTTGTCT
CTCCAACATCAATATCACACATGGTCCCACGTACTGCAGGGGGTAACGCATTTCTTTTCCCAATCAACAGGTGACGACTCTNNNNNNNNNNNNNNNNNNN
NNNNGATTTTCTGATAAGGGTATTCCAGGATCGCCGACCTGGACATCGTCTATCGTTATCTC