Description :
From Genome Similarity Track
Location :
Scaffold_1:5377644- 5409973
Transcript NameFunction/comments
Physo_473879double stranded RNA binding, putative
Physo_476299Hypothetical protein
Physo_556034Monovalent Cation:Proton Antiporter-1 (CPA1) Family
Physo_476674Monovalent Cation:Proton Antiporter-1 (CPA1) Family
Physo_381565Hypothetical protein
Physo_556039PREDICTED: E3 ubiquitin-protein ligase UBR2 isoform X2
Physo_478928PREDICTED: UPF0468 protein CG5343-like
Physo_310684Hypothetical protein
Physo_472190putative phosphomevalonate kinase protein
Physo_295385Hypothetical protein
Physo_465609predicted protein
Physo_310686peptide chain release factor 1
Physo_476172Hypothetical protein
Physo_556043elongation factor P, putative
Physo_556045spastin and Fidgetin-like protein
Physo_310690U4/U6.U5 tri-snRNP-associated protein, putative

Sequence
32329 bases(100 bases per row)
GCACGAATGCTGCGTAGGTTTTGGCTTTTCACGAGGCGTACGTGATACCTGGCACAGGCCTGCGGCTGTACAGGACGACGTTCCGCGACCAGTTGGTCTT
GCCTAGCTGGGCCTTGAAGCGGAAGCGACCAGCGGCCAGCAGAAACGCGTCGATCTTCTCCACCACGTCCGTTCGCACCTTGATCTCCTTGAAGGACCGA
GGCACCTCGACTCGCATGCGCTTCAACCGCGTATGCGCATTGCTATTTGTGCACAACAAAATAAAGTAATTAGTACGATTGGTAGCAGCATGTTCCCTCC
CATACAACCATTCACGTACCGATAGCATTTCCACGTCTGCGGCTCGATGATCAGGTGCTCCGTCATATCGCTGACCGTTTCCAGGAACTTCCAGAGGCCG
TCGTCTCCGTTGTTCAGGTGGATCCACATCGTCACACTAAAGCACGTGATGAGATCGAACTTTCGCTCCGCTGTCGAGCGCGTCGCCAGCTCCAAGAAAG
GCGTGATCTCCTTGCTAAACTTGCTCGTCATGACATCAACATGGCGAAACTGCACTGCATCCCCCTCCGTCAACTGCACCGATTTCTTCGCAGCTCGCTC
AATTAGCACCTCGTCAATATCGACACCGAGAACCAACAGCGGCTTTCTCGTTGCAAGTTCTGCTTCAGTCAGTGGAAGCTGCTCCGGAACAACCTTTTCG
ACTGCCTTCGTCTCCTGCTCTTTCTCCTTGCGTTCCGTGCCATCCAACGCTTTTAGGGCGACTTCAGCCGCCTTGGCCTTTGCGACTTTCTTCGACACAC
CCTCACCGTGACCCATGGTCTTGCCGTCAATCTGCAGCTCACAGACGTAGCGTCTTCGGTGACTCGTTTCGCCCTCGTCCTGGATCAAGTACTCCACCTG
CCTCTTCTCCTTCTGCATGCGCTCGTTCAGCGTGCTGATATTGGCGAGGTCGAAATTGGCCACGTCGTCGATCTGGTTGGCATCTGCAAGTACTGCGCGT
CCGTCCAGCGCGTCGTAGAGTCCGATAGTCAAGTCTCCTTCATTGCAGCCGATGTCGATGACCGTTGATGTCTCATGGGCCTTGTCCTCGGTCGATTTGC
GGACAAGCAGCGCGCGTCTCAGGGCATTGGCCGTCTGCACGTCCATAAACCGCAGGCGCTCATGCACCGGGTTGAAGCTGTAATAGGCGTGGAAGTTGCC
AAGCACATGGCCTTCCGCGTCCGACGCCATGGTGTCTGCTATTCGTGGTTGTCGAAGATGCGCTTGATTCACATGAACTACGCGGCTATTCGTCAAAATT
GGGATTAAGACGAACACGATTGGTCGAAACTAGTCCTTCTTATCTTTGCTTCCAGTTCGCAATACAAGCCTCACGTTGACATGCTGGGACGACGCATGTT
GCGCGCGGCGGCGCGTTCGTCGGCCGAAGCGAGGCGCTTTGCAACGTCTGCAGCGCAGACCGACACCAAGAGGTCGAGTGCCAACGAGAGCAGCTTCTCC
AGATACGCTGGCATGGCGTTTTTCGGCGCTGTGGTGCGCGTTCTAAACCTTGAGAAAGGAGGTCCAGCTACTAGGATCCTAGAGCTAAAGCGGCTTCTCT
TTTGTTATGGCCATTGTGGTGTAAATTACAGGCAGCGACGACGGCGTACCTCGGAACGTGGCAGGTATGCGTCTCGTGTTGCTGCAAGTAGGGGCTACTA
GCTGTTAGTGACAATCGCTTGCTGGAATGGACAGACTGAGCGCTACTACTGGAAGGTGGATCTGATCAACGAGCGCACGAAGGAGTTGTCGGAGTCCGTT
TCGGAGCTACCAAAGAATGCGACGGCGAGTGACGATGTGTGAGTCTTTTGGTAGAATGGTCGTATTGTTGGGGTCGAGGTGCTCACGAGATCTGGTGTTT
GGATTGCAGTGACGACATTGAGTATCGCCAGCTTCGTCTCGAGGGAAACTTCAAACCTGGAAGCACCTTCTACCTGTGTACGAATCCGATAAGGAGCTGT
GGCAGACGGATTGTATCTGACGTTGATTTTCGATATTTCTGTAGATCCTCGCTCGGCCCCCGCTGACCCAAGTGACTCGGTGGCAAGAGTGAAGTCCGGC
GGCTACCTTTACTCTTTATTGCAGCGTGACGATGGGTGAGTTGTTTGTTATAGCTTGAGGCTTTTAAGTAGGCTCGAAGCTGATAAGCCCTGCTGTATTG
CGTAGAACGCCAGTGATCGTGAACCGCGGTTGGCTTCCGCGCAAGCTTTTGGATGAACACATTGCGCGTGAAAAGAAGGAGGAGAGTGGAAAGATTTCTT
TTGTTGGCGTTCTTCGTCACGGCGAAGTGGTATGTCCGGTTGATGTGGTGCGGATAATTTCACTATACATTCCAACTCTAACCCGGTATGGCTGTGTCGT
GCTGCAGAAAAACAACTTTACCCCCGACAATGACCCCAAGAATCGCCAATTCTTTTACTTGGACCATGAAGAGCTGGCTGATGCCATGGGTGTCACTTCG
GTGGATTTGCCAGTCATCGTCGATGCACTCGGTAAGAGTCCTCAAAACGGTTTACGCCAAAACCTCTTTCTTTACTCACTCAGCGCGACGAATTCATGTA
CATTCTGCGTAACAGCGGTCGAAGGTGCGAGCGGCGAGACAACGCTGGACAACCCTCTCCGGAAGAGCATTGCGTCCTACTTGGAGTTTTACATGACGCC
GGAAAAGCACGCTGGCTACGCAGCGACCTGGTACGCAGAGCTGTGGTCAAGTGTAAGTGCGCTCACACGACTAACACATTCCAATTGGCAATTCCACAGG
TTCGGTTGCAGCATCGCAGCTGTGGTCATGGGAATTCTTCGTTTCAAGAAGGGAGGTGCCAGAGCTGTCCGTGCTCCGAGATTCGAGCACCGTTGAGCAG
GTGAAGCTCACCGCCACGAGAGTGTACCTATCGACATTCGTCTACAGCTCGCTAAGAAATAGTGAAAACAGCTGGTCCATTTTGCGTAATTCTTATGATT
TGCCCCGGTAAAAGCTGGCACCGGCTCCACCGTGGAGCCTCCACGTACCGCGCCAATGATAAGTGAAAATGCAGCACGAACGAGATGACGAGGCGGCTAC
GATGGAGGACGCGGTGCTGCTGCTGCTCATGCTGTTCGTGCTGGTAGTGGTGTCGTTCATGCTGGACCGGTATTCGTGTAATTTGGTGTCGCAGAGCGGG
TTCGCCATGGTGTTCGGTCTCGTCGTGGGGCTCTTCATGATCATGGGGGACAAGCACACAGCTCTGCATACGCACCTGAACCTGGACAACAGCCTCTTCT
TTGATGTGCTGTTGCCCCCGATCATCTACGAGGGAGGCTTCTCCATTAAGCGCCAAGCATTCTTCCGCAACTTCCCGGCCATTATGAGCACTGCTGTCGT
GGGCACAGTCGTTGCGGCGACCATCACGGGTGGCGTCCTGTACCTTGCGGGCGCGTCGAAGATCGTGACAAGGCTCTCGTGGGTGGAAGCTTTGCTGTTC
GGCACGCTGATCAATGCTGTGGACCCGGTTGCTACGCTGACGTGCTTCAACAGGCTGCACGTCCCACCGCTGCTATTCAACCTCGTGTTCGGAGAAAGCG
TGATCAACAACGCAGTAGCTATTGCACTGTACCAGACGCTACACAGGTGGGACGTGGGCACCGACTTGAGTATGAAGCAGTTGCTGCGAGTGGCTGCCAA
CACAAGTGGAATGTTCGTGGGATCGCTGCTTGTGAGCGCGACAATCACACTTTGCGGCGCCTTCCTGCTCAAGCGCAAGATCTTTTCGTCGCTGCACTTC
TTCCCCAGCTATGAGATTTGCCTCTGCTTGGTTTTCAGTCTGTTGACATACTACGTGGCTGACAGTCTGAAATTGAGCGGCATCGTGGCGCTGTTTTTCT
CGGGTACTATGACGGCTCACTACCATTTCAACGCACTATCACGCGAGGCACGGCACGCTTTCACGCACCTGCTGCACACGTTGTCGTTCTTGTGTGAGAA
CGTCGTGTACGTGTTCATGGGGACATCGGTGATCATGATTTTTTCGGGGCACCGAGAGCAGAATTCCGGTGCTGCGCTTCGGGTGGACGACATCGACTGG
CATTTCATCGGTCTCACCCTTGCGGCTTGCTTCTTCGCGCGCTTCTTCAATATTTTCCCGCTATTGAAGATTTCCAACTGCTCGCGCGAGTCCTGCGACC
GTATCCCAGTCAAGTACATGAGCGTGATGTGGTTTGTGGCGCTTCGCGGATCCATTGCGTTCGCGCTCGCCAAGAATTGGAATTATGTTGGTCGCTACGG
TTCGCACCGCCAACTCGTGGAATCTACCACTCTTGTGGTGGTGCTTTTCACGACAATTGTGGTTGGCGGGCTTACGGGCCCGATACTCTCCAAGCTGCGT
CTGACCGGGCACCACAGTGCACTTCGCCAGTCTGAACCCGATGTCAACTCTGAAGCGTCGAGTTCTAATGAGGATCGAGCAAGAGCGCTGCAGCGTAGCA
CCTGCCACTTCATGCTTCGTCGCAACTCTAGGGCCACGGAGCAACCCGCGCGACCTTCTTCAGAGGGGACAGAAGAAAACCAGGAAGTTATAGTGGACGA
AGACCCTGTGTTCACGTCGCGGCCGCAATTCCGGGACGACGACTACAGTGGCGATGAGGGAGAGCGCGATGGGGACTCACCGCAGCAACGCAAGGAAACC
CTGACCGGCGCGTTCTTCCGAAATTGGCAGGCCTTCGACGCTGCGTATATGCAGCCGATCTTCGGTGGCTCCCAGGCTCCTGCAAACCCGCGAGCAGTTG
ACAACGACGCAGCAGACTCGCGCGGCCAGGAGCTGGACAAGACTGCTGCAAGTGCGGTCTGATCTCACTTCAACTTACCGGTTTTGATTGTGTAATGTAC
ATAATTTCCCAATACTGGACTCAAGTATTTCAGTTCAGCAAATCACCCTTAGAATATCGGTTTGCTGACTAAAACGCATGTCTCATGCAGTCAGCGCACC
AATCAAAGGAAGCCAAAACTCACATTGCAGGCAAGATGGAAGACGCGGTGCTGCTGCTGCTCATGCTGTTCGTGCTGGTGATGGCGTCCTACTTGCTGGG
GCGCTACTCCTGCATGCTGGTGTCGCAGAGCAGCTTCGCCCTCATGTTCGGGCTCTTCGTGGGGCTCTTCATGATCATGGGTGGCAAGCACGCGGCGCTG
CACACGCACCTGAACCTGGACAACAGCCTCTTCTTTAATGTGCTGCTGCCTCCGATCATCTACGAGGCGGGATTCTCCATCAAGTGCACGGTCTTCTTCC
GCAACTTCCCGGCCATCATGAGCACGGCCGTGCTGGGGACCGTCATCGCTACGACCATTACGGGCGGCGTACTATACCTCGCCGGCCTGGCCGGCATGGT
TACCAAGCTGTCTTGGGTCGAAGCCTTCCTGTTTGGCACGCTAATCAGCGCCGTGGACACAGTGGCAACGCTGGGCATCTTCGACAAGCTGAACGCGCCG
CCGCTGCTGTTCAATCTCGTGTTCGGAGAGAGTGTGATGAACGACGCCGTGGCGATTGCGATGTACCAGACGCTGCACAAGTGGGACGCAGACAGCAACT
TCAGCGGCAAGCAACTACTGCGTGTAGCGCTGAATACCGGTGGAATGTTTGTGGGATCATTGGTGGTCAGCGCTCTCATTACGCTCGGAGGCGCGTTCCT
GCTCAAGCGCCAGTTCTTTGCGACGTTGCGCTACTACCCGAGCTATGAGATCTCGCTGTGTTTGATTTTCAGTCTCCTGACGTATTTCGTCGCGGACAGT
TTGAAGTTGAGCGGCATCGTGGCGCTATTCTTTTCAGGCACCATGACGGCACACTACCACTTCAATACGTTGTCGAGAGAAGCGCAACATGCGTTTACGC
ACCTGCTGCACACCCTGGCTTTCGTTTGCGAGAACATTGTGTACGTGTTCATGGGCACATCAGTCATTATGATCTTTGCGGGTCACGGGGAAGAGAATGC
GGGTGCATCGCTGCGTGTGGACGATATCGACTGGTCTTTCATTCTGCTCACGCTCGTGGCCTGCATTGTGGCGCGATTCTTCAACGTTTTCCCGCTGTTG
AGCCTCTGCAACTGCTTACGATCCCCCTCGAGCCGTATTCCGGTCAAGTATATGAGTGTCATCTGGCTAGCAGGTCTCCGTGGGTCTATGGCTTTCGCTC
TGGCCAAGAACTGGAACTACGTGGGTCTTCACGGGGCGTCGCACCGCCGCCTGATCGAGTCTACAACTCTTGTGGTAATTCTCATCACGACAATTGTGAT
CGGTGGTCTCACCGGTCCGTTGTTGTCGAGCCTGCACCTCACTGGCAAATACAAGGATCATAGCCACCTCGACCAGTCGGACACTGATAGGAGCTCCGCC
ACTGCGTCAGAGTCCGAGGAGACGTTAACGCGATTAGTTCAGCGTAGTACGCGTCATGCTGACGGCGACTTGCATGGCGCTTTGGCATTTCCGGAGGAAG
AAGCTCCCAAGGAGAATCGTGATGGCACCGGTGATGAAGTTCCGATCCTGACACCCCGACCGCAGTTCCACGATGACATGAGCGGCGACGAAGAGGACCC
GAATCTTGCTTCACCAGTACGCCGCGAGACCGAGCGATCGCGTGGGGATTCGCTGACCGGTGCATTCTTCCGCAACTGGCAGGCCTTCGACACAACCTAC
ATGCAGCCGGTGTTCGGTGGTTATTCGCAGCGTCCATCAGCATCGACATCGATTGACGACCTGGCCGATATGCAGCTTGCCAAGGCACAGGCCGAGGCCA
CAGTGTGATCTTTTTTAACGTAAATATCACTCGTACATATGCTCTTCAAGAGCAGCTTTTGCAGTTGCAGTTAAAAGGTGCTTGGTCGACATGGCTACAA
ACTATCGCCTTTGACGGGGTTTGCACTGCGGACGCAATGCTGCCAGTTAGCTAATTTCCAAGCGTCCAGGCGCATGGCGGTGCCAGCGCAGGACGAGAGC
GTCGAGGGCAGCGCTGCAGCAGCAGTGCAACCGATACCAACCGACGCTGCTCAGCCTAGTGCGCAGACGATCGGAGCGTCGCCAGCGCCCGATACCCTGG
AAATGTCCGCGGAGAGCGAGGGAGATGAGGCGGAGGAAGTGGATGACTCGGTAGAAGCGCTGGAGGACTTGATCCTGGAGGCGTACAACAACATGCAGAT
CGACGGAGAGTACATCTTCCTTCCGGACGAAGTGGCGGAAAAGCTTCACCGAGCTGCCGAGCAGGTGTGTGGGTTGGGCGTTGGGGGAGCAGTGGAAGTG
TGTTGTGCTGATCTGGTGGTTTTTGTGCTTGAGGTTTAGATCAAGATCCAGGACAACGGGGAGGAGGAGACAACGGAAAACAATACAAGTGCGGGGGAAG
ATAGCAGCAGTGGTGACATTGCCGCTGCTACGAACGCAGTGGAGGAGGTGAAGTCATCCCAGCAGACATCAACCGAACGACCAGAACCTGAGCAGGAGCA
GGACCAAGAACCGTGCAGTAAAGAGACGCTGAAGGAGAAAGAAGGCGAAGCGCTTGAGCATCATCAGACTCAAATGCATGCTGCGCAGAATGAACAAGAC
AATTTAGCTGAAGATGAGCACGCAAGGCTGCATAAGATGAAGGAGTTGCAGTCGGTGGCAGCAGAGCTGCGCGAGGAGAAGCACCAGCAACGAATCCCTC
GAGCAGTGTCTTCGGAGAATCTCTTTACGGAGTTGGAGCCTGTACCCGAGATTGACGAAAGCGCGTCCAGTGGCCCGCCATCACCATCGCCGCCGCATTC
CCGCTCGCATAGCGGAGTAAATACGCCGAAGCGAAGCTCACGCACACCAGCACGTGGAGGACATGGGCATTTTCCTCCACCGCCGATTATTTCCTTAAGC
TCCACTCCAAGTAGTGCCGCTGCTAGCCCAGACCAAATGGGAAAATCTCCAGCGTCACGAACATCAGATCAATCAGGTGGCAGCAAACGCAAGGGCAAAG
TACTCACGTACGAAAAGAGGAGGGAGGCCGCGCTCAAGCTGAAGCAGGATAAAAAGAAACGGGAGCTGCTCATCCGCGAGTCTGCGCGTAAACAACGCGA
GGACGCCAAGCGGCAACTCGAGGAGGTGCACCAGAAGGAGATGGAGGAGAAGCGTGAGCGTGTGCGACGAATTCGAGAGGAGCGGCTCCACCGCCAAACT
GGGAAAGGTGCGAAGGGATCGAAGAAGGCTGGATAGGTCTCCAATGTATATACTGGCGAAATAGCTATTTCTTGTCGTCACATTTCGAGTTGGGCGAGCG
CTCTTGGGTCCAACTGCTGTAGGAGTGATTGCATTCCACCAAGCGAGCAACTTACAACTTCAAGTTCGCGCTGCAAATTCGTCCTTTGCTCCATCATGAA
ATGCTGGTGCTGCTTCAGCCGATTTAGTTTCGTCTTGTATTTATTACTTCGCTTCTCGAGCGTGCTGTCAACCAAGCCAAATTAGTGTTTTCTGGTGGAG
AATTCCGAATAAAAGGGGAAAAACGTACCTGGAGTACTGATCCAGTTCGTTGACACAATGGTTTGCATACTGACACGCAAATTGTAGGAGAATGAGCGCT
TTTCTAACTATCGCTCCAGGCTCTGTCAGTTTCGAGCTCGCTCGTCGGGACCGTTCAGTATTTGTGGAGCCATAAAGTGTTAGCGGCAGTAAGTCGCGTA
GCGAATCCGTACGAAGCTGTTAGTCAGGTGGTAACACAGCACTTAGTACTCTTCCACGACAAAGAACGACATTATTTTCTACTACGCTTACCTCATGTAC
GATTTGACCGACGCGAACGGAGCGTAGCTTGCTGCTTCTGGCAAGATTGCGACGAGGGAGAACAAAATGGAAATCTGGTTTCTTTGTCGAATGCATTGTA
TCCGGTGGGGGTGGATCAGGTCTTCCGAGAGGCGGGTTCTCAATCGAGGCAATGCTGACGCGCACATAAGCTGCCGTGTTGCTTAACTCTGCCGAGCTTT
CGCAGTATTCGATTTCCCTTGACTCTAAGCCTTCTGCGTGTCTTTTTCCGCGAGGTGCGATCGGATACCACCGCTCCGTTGTGCCGGACTGGATCGAGGA
CACCAAGTCCACGCTCCACGTCGCCACAAATTGAAGCAAGTCGGTCGAGCGCGACTGCGCCGTCCAGAGCTCAAACACAACAACATCACAATGTTGGACC
TGCAGCTCAACTCTAATGTCCTTCTTCCATTTGGACTGCCCGTTGTCGCCCTCGCGAAGCAGACACTCGTCCAGCAACAAATGATCTTTTCTGCCACAAC
CAAGCGGGTACATTAGGCGTTTTTAGGGACAAGTCGCATTCGCTTCCACATACAAACCCTCTCTGCCTTTTGCTCGCGCGCGCAGCCACGGCCGCCCTGC
CCCCTCTGTGCCTCCGATGCCGACTACAGTCACCAGCGTCGCCGCCATCGCCTCGAGCCGCGAGCGACTGTAACTGCGTGTATCTTGAAGCGACACTGGT
CGTACTTAATCGAACCATTGGTGCCAATTTCCGTAGAAAAGAAACGACCATCACTCTCACTTCCGCACTCCGTTACTGTGCTCAGTAGCGAAGCCGACCT
ATGGTGGCGATCCGGGGGAAGAAGACCAAGGCTTCGGCCAAGCCCAAGGCGGCGGCGGTGGACAAGGCCGCGTCCAAGGCCAAGGTGCCCGCCTCCAAGG
AGGCCGAGGCCGCGGCGGTCACGCGGCTCACGCCGCAGCAGCAGCTCTCGCGTCGCCGCGAGCAGGAATACCTGGAGCTCGTCCGCTTCGCGCTGCACAG
CAACCTCGCCCGTGGCGAGGCCGGCAGCGCGCTGGCCGCGGGGCAGTCGGTCTCCAGCGTGTGTAACGCACTGATCACGTCGCTCTGCGCGTCTGCGAAG
GAGAAGGCGCTCGCGCCCGCGCAGATTCTGGCCAAGCTGCCGCGCACCGAGCGCAAGCGCATATGCGGTGCCATCTTCTCGGCCGACGAGATCGCCTACA
GCTGCCGCAACTGCCAGTTGGACACCACGTGCGTCATGTGCAAGGACTGCTTTACGCACAGCGACCACGCGGGCCACGACGTGTATTTCCAGAGAACGAC
GGCGGGCAGTTCCTGCGACTGCGGAGATTTACATGTGCGTCGTGAGGACGTTTTTTTCTTCCTTTTTTATTTTTACAACGCAGTGTTGACGTTATTATTT
TAACATTTTCTTGTAGGCGTGGAAGCGGAGTGGATTCTGCTCAAACCACAAAGGAGCGGAAGGATCCGAAGGCGGAGCAAAGAAGCAAAAGTTGCCCAAA
CATATTGGATTGACAGCGCCGGTGGTGATCGATGCAGTTGTGGAGCACATTTACCAGGTGTTATTGGGAGTGGATTATGGATTCGAGCTGGCGGAGGCGC
TTGAGTTGTTTACGAGAGATCTTCCGCCTAAATTTCTACCGATCCAGAGCGATACCGATGTGGCAGACGCTTCAGCTGCTGCAGGCTCGAGCCGAGCGGT
GTCGACGCGGTCTACCCGACTTTCAGCGCAGTTTACCGCTGATCCTGGCGCAAGAACAAATGGACCGGGCGGACGGCTTGAGGCGCAGCCTAAAGAAGTG
AAGCGCGAGTCGATCCTTTCAGACAACGGCTCGACTACCGGTGTGCAATTTGGAATTCGCTTGCACAATGACGATGTGCACTCGTTGAATGAAGTGATCA
ACCATCTTTACGTGGAGTTGGGGATGTCGAAGCCTCAAGCGCGCACAGTAGTTCACCAAGTGGACAGTCAGGGCGATGCAACGATCTCAACTAAGCCGTT
GCTGTTGTGTCCGGCAGTTGTTGGAAATCTGGTTCGTCGCTCGCTGAACATTTCGGTGGCACCGACGTGGTGGGAAAAACAGATGGAAGGAGTGCCTGCC
CTTTTGGAGTGGCTACAGTTTGTCAGCACCACCTCGGATGGTCTCAGTGAACTAGTGTCTGAAGCGTTGCAAAAGCAGCGGTCGCCAGATCTCAGAGGAT
TTCTTCCTGTTTCGCACAATTTGGCAAAAGGCAAGACGGTACAAGAATTTGTGAAGGAGCGCAGCATTCGTTTGCACAATCATGCCTTAGATGTGCTCGT
TGCGCTGATCGCAGGAGATAAAGACGTCTTTACGTGGGCATCTGAACAGGAAACGGCACAGCGACAGCGTTTCGATTTCAGAGCAGAAGGTGTCCAAACT
GCAGTAGCATCTGCAGGATTCCTGGCGGAAGGGAACCGGGTTAGCTGCAAGAACGTATTTATTGAAGAGTTTGTCAAGGGTGTGTCGCTGAGCCCCTCAT
ATCGCCGACATGACAATGTTCGAAAAAGTTTCGATGCCGTTGTGTCGAAGTACTTCACTGCCGAAGGGGTGCAAACGTCTGAAAGTTTTTCGGCAACTTC
TTCGGCTCTGGCGTTGCTGATGCGATACGACTGTACGTTGCGGAAGAACGTGGTGGAAAAATCGCATTCGTTTTTGCGTGAGCACTTGGTCGACATTCAA
TTTCGGGCGAGCATGTTGGAAGCATACTTGCGATCATACGCCTCGATGACGAGCATGTTCTTGCGCGGTTTGGGCAACTCGAGTGAATCGATTTTTGATT
TTGCTGTGCAGTTCCTGACAGTGCCTCATCTAGTACAGAACTACACAAAGAAAGAGGTCTCGAAGCACCCTGGGCGACTGGAACTCGTTCGCGAATTGCT
CTGTGCTCTGAACACGGTATTTCAGTCGGCCGTCAACGAGAAAGACAAGATCCTAAACGCGGATCACCCTGCGTTAAGCAGTCAGAAGTACAAGGTAAGC
TCCCCAAACTCTCGTATACTGCCGAAGACTTGTACCTTCTAACCAAATGTTCTGGTACTGGGTATTCTGTAGCATTGCATCGAAAATATGGAATACGTGT
TCAATATCGGTACGCTTTCGAGCGAGCTGGTCTGCAATGAGGACAATTTGAAGGTTTGGCTGTCGTGTCTGAGTATTTTACAGGTAAGGACTCTGCTGAT
GTTTTCCTCTGAACTCAACACTTAAATTACTATCGTGCCGTGTGTCGTAGGGCGGTGATCCTCAAGTCCGTCGAGGTATCAACCAGAATCACGTGGAATA
CGAGTCCGACAGCTGGTTGGCGATGTTTAACCTTGGTATCCGCGTCCACTCAGTGTTTGCTATTTCCTGGAACGGCTATAAGCCGTCAGAGTTTGAATGC
CCCGAAGCGAAGATATCAGAGACCTTTGGCCCGATTATTGACGCTACCCTCTCTTCCTCAGCTCACCTGAATGAAAAGGTGAAAAAGAAGAAACTGGTTT
CTGTGGCAAAGCTTGCGTCTGGAAGCAAACGGGGTGCTGGGGGTCGCGAAAAGTCCATTGTGACGTACGACTTCAACGTTGCATCTCAGCCTACTTCTCT
CCACATCCCTTTGCACCGTTTCCTGACCGCTGCAGTTCGACATATCTGCATCAGCCCAACTGGTTTAGGGAGCTCGATTCCAGCAGATGGTCTCTTGAGG
GTGTTTGGATTTGATAAGTTGCCGGCTGACAAGCAGTGGGAGCTTGTGGATATGCCTCTCCGTTGCCTGGTGATGGCATCTCAAATTCACTCCAACCTGT
GGCGCCGAAATGGAGATGAAAATATGCTGGCACAATTGTACAACTACTCGGCGCTACCGTATTGTATTCATTACCGCGACGCAGATACGCTCATGCTGCA
GCTCGGTGTCCTCATGACGGGTCCAGACGCGCTCTTGTCTCGAATGGTGGATCGATTTCAACTGGGCAGTTTTTTCGTCTTGACCGATGGAAGTGGTGCT
GCAGCTTCCAACGATGCCACGAGTGGATCTGACGACTTGGCGAAACAATTTGGATATTCGCCGCTGGAACAAGGTATCGACGAGCAGCAGCGCTTGCAGA
TGCTTGAGGAATTTCTGCGCCTCGTGATTATCGTTGGTACCAGTCTCCCGAGCGCTACCGGTGTTGCATACGACGATGAGTTTCTTGCGGAAGAAATGTT
GCAGCAATTGTGCGCGAAATCACTCCCTTTCAGCAAACTGTTTGACCTTGCTATCCTCCCGTCAGGACAAGATGATATTCCTACAGCGCGACTTGAAGGA
GTTCTTCAGAAGGTGTCCAATTTTGTCGCGCCGTCGGGAATGGAACCGGGTCGGTACGAATTAAAGGAGGGTTTATTGGAGAGGTACAATCCTTATTTCC
TCCACCTGAATCGTGAAGCACACGAGTTAGCTCGTGATCGTTGGACAACCCATCGCAACGCATGTCGCCAAAAAGCCAAGAAGTCTAACCCCGATGCCCC
TCCGAAGGAACCGTTGAAGGCCGCCAGAGCTCCAGTTGAGTTTCTTCGTCCAGTTCAAACAATTTTGACTTGTGAAAGCGCTGTTGCAATTCTTCAGGTG
ATTCTTTGGAAGGTAATTTCTTCGGCCCACACTTCAGCGACGTCGGGCTCGGAGGATAGCGTATCGGACGCCGTGATTTCGACCTGCTTGCACTTGCTGG
TGCATGGTGTTCACACGGCCTCGGAATCAGCAGACCGCCGCTTTTGGACGCGCTTGAGCAAACCGAATACGGCCACTTCTAAGCTGTCGGTGCTGAATCT
TCTGAGTCAGCTGCTAGCCCAAGCGGCAACATTGCTCGACAGCGAACAGACCGGGACGGTGGAGTGGCTCATTTGGAAAATTACTACAGAATCGCCCGCC
TGTAGAAAAGTGTTCGAGCAGCTAGCAAACGACGCAAAAGCGAAGGAAAAGAAACCGGAAGTGTCTCCATCGATAGTGGGTAGCACTACACAAGGCGGCA
ACTCTCCACCGATGACCTTGGAACAGCGCAAAATGGAAGCAAGAAAGAGAGCAATGGCTGCGATGGCGAAACGCCAGGCTGCGTTCCAGGCAATGGTTGA
TCTCGCAGACGACGAAAACGAAGAGAAGTCTGAAGAAGTTGGAGATGGCGCGAGCTCTGTATTAAGTAAACGAAAGGCGTCAACGGTGGAAGAACCGGAA
GAGTCTACGAGTAAGCGCCAAAAGGTGGATACTGAGCCCTGCTACAACTGCATTCTCTGCCATGACAGTTCGTCACAGGGTCAAATGGGAGTGGCGGCCT
ACGTCCACCAGTCGACTGTTCTCGCTCCTGGATTTAGACCTGAACCCCACGAAGCACTGGGTCCAGAGGGTAAGAAGGTGCGTAGTCACGTGAAGAAAGT
CATCGAGAAGATGGAGTTGTGCTCTGGTGGAAGCTCGACGCCGTCTGATACGGCGAACTCTCCATCCCCTACTCTGCGTGCATTCGCTACTTCTTTTCCC
GAATGGTACATGGATGGATCGTTGGAGGACCAGCTTACTCGTGATAACACGGCGCAGAATAGCCCGCGCCCACCAGTGGCTCGTCGCCAAAACAACGACC
GCATTCGGTTCGGAAATGGTCCTGTAATTGAAGGTGAGCTTCTGCAAACTGATGATGAATTGGAGGTTCTCGAAAGCGTCATGGATCTTCGCGAGGACCA
ACAGCTTTTTCCAATGGACATGCGTGGTGCTGTAAGCTTGGACCTTCGTGGAGATCGTGTGGAACCTCGCAGATTGGGTGGTCGCGAAGTAGCTGGAGGT
GCTGCTGCGCGTCGCCAAGGAGCACCGATGGATGACAGTGACGACGATGATGAGTTTTCATCGCGTTTCCGTTTGGAACGCATGCCTCCCGGCTTTGGTC
GCCCTCACGAAAGTGCTAAACTCTATCTCACTCCTTGTGGTCTACATGTCCGAACGTGCCAACATGCAGTCCACATCCACTGCCTCGAGCGGTACATCAC
GTCCTTGCATGATAAGGCCATGCGTGGTGAAGAGTTTGATGGTGTTCAAGCGATAGATCCGGATTCGGCAATGACGCAGTTCCTCTGCCCGCTGTGCAAA
ACGTTGAGCAATTTCCTGATCCCTACCTCCGAGCCCCGAATCTCGATTGTAAAGGAGAACGAGCATGACCGTAAACGCTCTGCAGTTGCGTCCGGAGACG
AGGAAACGAAGTCTCGAACATGGGACACAATTGTGGAGGAGCAATTGTCGATGCCGGGGTGGTATCGTTCGGTGCTTGGGCGCGATGGAGGATTTGAAGA
CGACGAAAATGAAACTGAGCATGATTTGTGGCGGGATTACTTCGAGGAGACGCTTTGGGAGCCTCATGGTAGCCTTGAGAAGGGCGCACCTTTCTTATGG
TCCGCGTGTGCTTTCACGTTGGCATCTTTCTTAACTGTTGCTGATGACGAACATCGCAGTGCATCTGGGTCGCCTGCTCCGTTCGATCCGCTTGCGGATC
CCTGTCCACCGTCTCTGGAGAAGGAGATGGAGTCGCTAATAGCAGTCACGAAGTTCTGCCGATGGACATTTTCCCTTTTGGAGCACAGTGCCGACGCAAA
GGTCATCTGGGAGACAGCTAAACGCTGTTGCCCGATCAACACTGAAACCAAGCGCGACTACCGCAAGTTCACAAAGGTAAGATTGTTTGGTCTACTTGAA
TCTTGTATGCAGTTATGCTGGATCTAACTTTCTATATTCTCTTGGTGTAATAGGTCCTCGGCTCTATTGATGCTTGCCTTCGGGGTACGATCCTGGGCTT
GCTAGTAGCGGACACATTCACGGTAAGCCAAATACTTCGCGTCGCGCCTTAGATCAAGGCTCTAATAGTATTTTGTCTACTGTAGGCTTTCGTCGTTGCT
TGCGTGATCGCAGACGAGCTCGAGACTATTTGGCAGTTTATCCCGGTTTTTACCGCAGCAGATCTGTTGCAACGACTTCATGCCGAGTTCTTCGAGCCTA
GCAAGTCACAGGGCACATCACTGTTTCAAGACAAGTTCTCCGTTGTTGAAGCAAGTGAGATTGAGATGGCTTCTCAAGCAGCAGAAGGTGCTGATGAGAG
TATGACTTCGCGACGAACCCGCAGTGGGCGTGCAATCAGCCATGTGGCATCAACTCGACGTGCTACGACTGCTTCTGGCTCCGTACAGCAACTCATGAAA
GCGATGGAAGCTGCCGGAGATAGCGGCTCTGAAGCGTACGCTGTGTTACAGCTTCTGCTGCGAATGGCTAAGGCGTTTCCTTCCGAGAAGCTGAAGCCAC
TCAGTTCTGCAGGCGATATCAATATGCGGCTGAAGCGCATTTTGACACCGAATGCGGCGTTTGTTCGGCGCATGAAACTTTTCTGGCGCTGCCTTGCGGA
TAAGGAGGCTAACGATCCGGCAAACGCTAGGACAATGCAGATCCCCACCTTGGTCGATATTGCCCACAGTTCGGATGCTACATTCGACCAAATCTGGCAA
TGGTGTATGGACCGCATGCTCAGCAAGACACATTTGGGCAGCTCGAAGGTCGGCGACAAGTGCGAACACACAGAAGGTTGCAGCGAGGCTTATGTGGCGA
GTATGTTCATCCTTCGCGAAGTGCCATCACGACCACGCCTGATTGACTTGCCTATCCAGTACGACGAGCTCTACAGCGAAATGGCAGGGCGGAAGTGTAC
AAGGTGCGACAAGTCTCCTTGTGACCCAGGCCTCTGTTTGATTTGCGGTGAATTTCTGTGCTGTGGAGACTCGTGTTGCACTCGTGCCTTCATGCCACAC
GGCCCGCCTGTAGGCGAGTGCACCCGGCACGCTGCAGAATGTGGAGGAGGAGTCGGCATTGTGCTTTTGCTCGAGCAGTGCCGCATCGCGGTTGTGGGCG
GCAGCATGGCAGCCTACTTCCCAAGCCCATACGTAGATACGCATGGTGAAGAAGACATTGGCCTCCAACGTGGCCGGCCGCTCCGTCTCGATGTGGCTCG
CTACCGGTATCTGGAGTCGCTTTGGCTGAATCACCGCATCTTTACTGAGGTATCGCGCCAGCGCAACCAGCGAGACCCGCAGTACACGATCAACCTGTCG
TATCTGTAGGTAGGCATTCGAGAAGAGATATCGTATTGCTGCTGGATGAAGGTCTTTGCACGGGAAATAGAGCAGTCTCACAAAACTTAAGAACCAACGA
GCATTCGTGTTGCTTTCCTCCCTCCAGACTTAACTCATCGACACCTACGCGCCAAGGAAGGTAAGGTGTGCTGGCAGATCGGCATCAGCGTAGCGTTCGT
CTTGAAAAAACATTCTCAGAAGGCGACAGTTGCCACGAATGCGCACCTCCGTTGTCGTCACATGCCTTGTGCCGAACGCTTGGTTTGTGAGGTCCTGCAG
GTCCATACAGAGGTAGCGCCACCCTGGGTGCGATCCGAACGCCAGCGGCAGTTGGCACGCTGTGTCTTCAACTCGTGCCAACGACCGCGTGTTGGTCACC
GTGAACACCCGATAATTCTGCGAGTCGTCCAGAACCTCGACCTGAAATTCGAGGAACAGGTCCATGTTTTTGATGAACATCACGAGGTAGCGGAAGATGT
TGCGTGTAGGGAACACGAGCTCAGCGTCGTTGCCAAGCACCTGCACCACGTCTTCCTTGACTATTTCATCCTCGAGAACGCACACGTCGTTACCATTCAT
GAGACAGCGGCATTCTTCTTGCGCTTGCAGGATAGCGGGGTGCTCTGCAAAAGGTAGCACTACCGTCTCGGACAAGATGCTGGCATTGGAGCTCGTGTTG
CTGCCCAAGCTGCTACCTCTGTGCTTCGTATCCCAGCCTTTGGATTTATCCGATGCGCGAACTGGTTCTGGCTTGAGGTCCTTGACGAGGACTTTCGGAA
GGAGGCATTCGACGTACAGATCTCCAGGCGAATACGAGCCATCTCCGATCCGCACGAAGGAGGGGGCACTCGACAGTGACGAAGAGAGGGTGGGAGGTGT
CGATAGCGAGCTCTCGGTCTTCATGATCTCCTTTATGAGATGAATGAAGCCGACCCTTGCGATCCCGAAATACCAAAAGGTCACTCCATATTGCCAAACC
GCCTCTTGGCATGGAGGAACAACAGCCATCGCCAGCACGAGCGTTCTTCCTCGCTCACAAGGACCTCTTCCAATATGAAAGGTACGTTGGCAATCAAGAT
CCATTTCGAGACGTGGTCCACGACCAAGAAGACGGTGGAGCTGCAAAATCCTTCCTTGAAAAGTATCGCGAGATAGATCATGCTCAACCCGAAGTGGCAT
CATTATCCAAGCTGCACTTCTCGCTCCTACATCCCCCGGCCCCCAGATATTCAATCGCGAACCCAGCAAGCTCCGCGTCAGCTTCATCGCCAGCATTTGT
TGCTTTGCAGTCAACAGCTTCCATTTTGAAGAACTTCAACGATCCGCCGCGCCAGCCAATTTGCTCCAAAGCGTTCGTGAATTCGCCTCAAGCCGTGCAC
TACCACACGCAACAACAGCCTGTTCCTCTTGTAACTTCGCACAACCCTGCGCCACCTCAAGAATATCGAAGTCCCGATCGTGTCTCCGCCTCAATGATAA
TGGCCAACACATCCGATCAGTTTAAACTTCAACAGCAGCATTCCCCCCTTCGGTTTTCAGTCGAGTCCAAGCACAGGCCCTTTCGCCTTCCAAAACTCGC
CGAGCTGCTGATTGACCCAGAAACTCGCGCTGCTGCCACCGCTCACAAAACCTGGGATGAAGCGCACAAAATCGAGGTGCTCGTTGGCAGCAAATGCGTC
GGTCGTGTCAGCGCCGTATCACGAAATATCCCGAACTCAGTTCGCTTGCGCCTTCGTGCGTCTGCTAATGTGTCTGTGCGACGAGAACGATTATATGACT
TGCTTCGTCAAGATTACGATATGATGAACAAGCACTGTACGCAGTAACGACGCACCAACGAAACGGGGACTTGGAACACGTCGGCAGGGATGAGGAGATG
TTGGTCATTGCATTGGAAAGAAGGCATCATCTGTCAGTCCTTCGAAGATATTAACGTTGCTGTCACCATATAGTGCAGAATCTGGTGGCATATTCATGGA
TCCTGCTCCGGGTTGCTGTGGTGGATGGTGAGGAAGCTGATTCTGTTGCTGAAAAGGTTGTAGTCCACCAGGTGCAGGCTGAAACTGCTGATTTGGCAGT
GCCTGCGGCATCATGTTTTGTGATGAAGACGTTGGGCCAGTCGACATCCCCCCATAACCAAAATTGTTGGGCATCATTGATGCGCCTTGTGCTCCAAAAT
TGCCACCACTCATAGACGCCATCATCTGCTGCTGTTGTTGCATCGACATACCAGCCATACCAGCCATCGGGAAGCCGCTTGAACCGAAGCTTGGATCGGG
GCTAAACCCGAGCGGGGTCATAAATGGATCCACAGGAAAATTGTTACCGCTGCTGCTGTTGCCGGTGTTGGAGCTGCTTGCCGACGTCGGCACCGAAGAC
ATACCATAATTGTTGCCGAACATATTGCCGCCACTCGATGGTGCCATATTCATCGGCATGGGCATTGGCATGAATTGCTGCTGTGGATTCATCATCCCAC
CGCCCATCATGTAGTTCTGCTGGTTCATAAATGCAGCGGACGCGTTGGGTGCCCCACTGGTAGAGGTCATGTACGCGTTAGGCGTGAAGGTCTGCACCCC
TGAGCTCATTGCGTAACCTTGAGTCGACGTGGTAACACCAGACACTGCCATTGAGGTCGTTGACGAAAATCCAGACGAGGTCTGCATCGGGTTTATCTGC
CCCGTCGGGAAAAACATGTTCGTACTCGTAGACGCGAATCCTACCGTCGGCATCGGGGGCTCAGGGAAAAGAGTCGGCGGTGCTGCTGAGTTCATGTTTG
GCATCGCCATTGACGCCGAAGTCGACACGGTCGACGCAGGTGCAGCAGATCCAGATGCCATCGATGCTGACGCTGCCATCGCCATCGGATTGCTACTACC
CATTGTCGAAACCTGTGGCGGCGCGTATCCCTGTTGGGGCATAGATGGTGATGGTTGACGTTGAACCTGTGGCGCAGCAGCTCCTGTGGACGCTGGATCG
GGCTGCACCCCTGTCCTCTGAGCCGAAGCGCCTGCAGTCGGCGAGACCCTCTTTCCTCCAGCCTTTTCATCCTCCTGGGCGATCTGTTTGTCCGCCAGCG
ACGCCAGCACCTCCAGCCTTGCTCCAATCTGCTGCCGGAAGATCAGGCACCTCCTCACCCACTCCTTGTGCTCAGCCGGGTTCATCTTGGCCGCTGCAGC
AACGTAACAAATAACAGACATCATAAAGACATTAGTAAGAAGGTACTAGCTAGTACATATAGTACTGCGTGTGTCCGTACGTTGCTGCTTGTGCAGAGCG
TTCCAGCCTTTCAGCGCCGCCTCGTTCTTCTCCAGCATGGTCTGGATCTCCCGCTGCGAGATCTTGCGCTCCGTCGTCAGCAGCGCCTGCAGCAGCAATA
GTAATAGCAACCATGGAAAATGTGTTGCGTAAGCATGCGGTAGGATAACAGAATTACTGTTGCTAAGAGTGCGAGAATGCGGTGGACTTTACGCACCTGC
GCCGCGGCGGCCGCGCGCTGCTGCAGCGGGTTGGCGTGCTCCCTACTGGACACAAGAGACGTATAGAGCGCGTGAGAGGCTGTGGGGGGCCGTAGGGACC
ACAGACGGAGTCACGTACGGCGCCGAGGACGACGCCATGCCCGGTGGAGGAGGAGGGCGGATTGAGGCGAGGCGTCAAGTGGAATTAGGCGCAGAATTAA
GGCCCGAAGTAAGGTTTGAAATCGAGCCAATCACAGGATTTTACGTATGAAGTGACCAATGAGAGATAAAGCCTACCCCTTTATGACAAGCTGAAGCTGA
GGTACGTGTACTGAGCTCACTTTTGGCGACGTGGCGATACAGAGCATGGCGAACCTCCGCCCCACGTGCGTGTCTGCGCCCGGCAAGGTGCTGCTTGTGG
GCGGCTACCTGGTCCTGGACGAGCAGTACTCGGGGCTTGTTTTGTCGAGCACGGCGAGGTTTTACTCCCAAGTGGGGGTTGAGGTACGTGTGTCAATCAC
TGCAACAATGGAGTTAGTAAACGCTAATATTTATCGTTAAAATGCAGATTTTGGGTGAAGAAGACTCGATTTTTGCTTCCCACTGCGAATGGCGTCGTCT
CTTTCCGTTGAAGGTGGAGAGTGCGCAGTTCGACCAGTTGATCGACGGCTGGATCGAGAAAAATGGCGATGGACGACTCCGATTCCAGCTCAGGTGACGA
GGAGTTACGTACGGATTAGTGAAGGGTCAAACAGAATGACCTTATTTGCGTGATGGCAGGGAGGGTTCGCACCGGAACTCCTACATTGAGGAGACAGTCT
TGTGTGCTGTGAATGGCATTGCTGGATTGGACGAGTTCAAGAGCAACGACACGTTCCAGCAACTAGCGGAGGAGAAGAAGGGTGCTCACGTCACGCTCCG
CGGTGATAACGACTTTTACTCCCAAGTGAAAAGAGTATGATCACCTTTACGTTGGAGGGATGGATGGGGTATGGGCTGTTAAGGCGCTGACATTGGTTTT
GGGTGTAGTTGCAGGACGCAAAGCTGCCGCTTCGTCGCTCGAACTTGAAGGCATTGAACGCATTCCTCCCACCAACTATGGAACGTAGGTTTCACAGGGA
CAATGCTTGAGAGACGTTTTGTACTGATACTTGCCTTTCAGAGCGCGGCGACAAGATGGTGGCGTTGAAGACTGGCATGGGTAGCTCTGCCGCCCTGGTG
ACGTCCCTAGTTGCGGCACTTGTGGCCTTCTTCGTGCCAACCGCGAACTTTGATACCCAGCAAAAAGACCTGGAACTGGTGCACAATTTGGCTCAGCTGA
GCCACTGCTACGTGCAACGCAAGGTAAGGCTAACCAATTTGTCCTTCCTAGAAGCAACAACAGCTGAATAACTAGTTGTTGTATTGTATTCTACAGATCG
GCAGTGGATTTGATGTATCGGCCGCATGCTTTGGCTCCCAGCGCTATACCCGTTTCCCTGCAACAACTTTGGATGCATTTACATCCGAAGATGCCATGAA
ATCGGGCGAAATTGTTCGTTGCATTACTGACAGTGCGCTGTGGAACACTTCTAACCGTGTGGTATGGCTGCTCTGCTTGTCCTGGCTTTCATTTCAACGT
TACTGTAGTAACTACTATGCTTACTAAATGTGTTGTCCTTGCTTGCAGAAATCCGTTCGACTACCTTCAACCTTCCACATGATCTTGGGAGACGTTTCGT
CCGGTTCGGCGACGGTGTCGATGGTTCGGCAAGTGTTGAAGTGGAGACAGGAACAGCCTGAACACGCAAAGAAGGTGATGGATGAAATCCACCACCACAA
CACGGAGGTTGAGCAAGGGTTCGCGGAAATCTGCGAGCTGGAAGACAGCCTCAGTACGCCAATCGATTGGGCAACGATGGCGGCTCAAAGCCGTGAACAG
GTATATCGATGCAGCATTCTTTAGTACTGCTACGCTGTACTTACTCCGTGCGTGTGATCTGCAATGAGTGTGTACAGTGGGGCACTACGGATGCTAGAAT
CGGGGCTATACTCATGAGAATCAGCGAAGCATTCTCCCATTTCCGAAAGCTCATGCGGTAGGCTCAATATTACACTGCATAACGGTGACATAAGCTGACC
TCTTTCGACGTTGCAGTGAAATGGGAAATGCTGCAGGAGTTCCGATCGAGCCACCCGAGCAGACGGCTATCCTCGATGCAACGATCGCTCTTCCGGGTGT
TTTGGTTGCTGGTGTGCCTGGAGGTACTGCTACTCTTGGTGTGTTAAGCTGGCTTGGTGAATGTTGAACTGACCAGCGATGTGTTTCTTATGATCTTCAG
CGGGTGGATACGACGCAATTTGTGTGGTGGTGCTTCACGAGAGTGCTCTACGCGCAGTCGAAGACCTGTGGATGCAATGGCCTTCCACCCACCCGGACTC
CATGTAAGACTCTTCAATGACTTTTATTCTGAAGGCGCAGTTCTGACCTATAACTTGTGCTTCGTGGTGAATCAAACTATTATGATAGTATTTGCCCGCT
TTTGTGCGATGTCGACCGTGGATTGACAGGGTCATCCGCTGCACGATCTGGACTTCAGCTACACCCCGTCGAGTAGAGCTGCAATCCATTGGCATTTGCC
GTTAGTGTGTTCTACTGATTGTCGCTAAGCCCGAAATATGGCGGTCCATACACCAGATCTTAGAGCAGACGTCAGGGGTCACCCCTTCACACATCCAACA
TGCAGAGTTTATCAAAGCGGAAGGTTCGTGACGAGGATGATGCTGAGGATGACAGGAAGCTAAAGGCAGGTAGCGATGGCGGAAGTACCGATGAAAAAGG
GTGGTTCGGTGCTGACCTGCACGGTGCGGGTCAGCAGCTTGCAGACTTTTCAATTCCTCGGCTTCGGTTCGCTACAGAGTCATGGGCTGGACTGAAGACT
ACCAATGAAGACCGCAACGTTTTCTCCACCGAGTTCTTCCCTGGTCCAGTGTTTGGTGTATTTGACGGCCATGGCGGAACATTTGCAGCAGATTTTCTAT
CTCGACAGCTTCTGAAGACTGTAGCCTCAGCGATACGACAAAATACTGGCGAGAAAGCGCTAGCTGATCTTCGCGCCTGCCGCAAACTATCGAGCCAAGA
AAACGTTCGCCGAGATGCTATCGTCGAGCAGAAAAATCTGCTACGTCAGCAGCTTACTGAAGTGGAAACTCTGAGATTGGGAGCCACAGATCCCGAACTG
GAAATGCTGTTTGATCAACTTACGAGTGCCATTTCTCAGATGGAGAGTTAGATGGAGCAGATTGATACCGAAGAAGCAGCACGTCATGAGAAGAGGTGGA
AGTGGTGCCAAGAACAGCACGGCCATTTCGTGGGGGCATTCAAAGATGCTTTTACGAGAGTTGATGCGCACATATTGCAGAAAAATCCGTCACCAGACGG
CTCAACCGCTCTGCTGGTTTGGTTTCTAGCCGACTCGACTAGCCGCAGTGTTCGCGATGTAGACGCTAGAGGCAGCAGCGAGCTAACGGATGAAGGAATG
TTCTACACAGTGAACCTAGGAGACTGTCGCGCCGTTCTGTGTCGAGGTGGGCACGCTGTGCCGCTCACAAGTGACCACAAACCCAGTCGTCCGGACGAAA
AGAAGCGCATTGAAAAGGCTGGAGGTTTTGTGGGAGAAAAGCTGGCATATCCCGCGTATACTCTGCTGTGGGCGCTGGGTTGACCATACAACAGGAGGCA
TCCACGTTCGGGCATTTGGTGACCGATCTTTAAAGACACCGACAGCGCTGGTTTCATGTGACCCGGAGGTCACGAGATTTCAAGTACAGGAAGACGATTT
GTTTCTGGTGATGGCATGCGATGGCGTCTGGGACGTCTTGAGCAACCAGGACGTCGTGGATATCGCGTTACCACACTTCCAGGATGCCGAAGCCGCTGCA
AACGCGATCGTTAAAGCTGCCTACACGAAACGTAGCGTAGATAATCTGACCGCTACTGTCGTCCAATTCGGCTGGAAGGCTGACGCCCTGGTGCAAGACG
CCCTCAAGAGCAGCAAAATACCAGTAGACAAATCAAGCGCCTCGAACGACGAATCTAACGCCGCAGAGGAAGAGATCGACATGTTCAGCAACGAGTAGCT
TACTTTGGTTGATACCCTTGCTCATACGAAGCGATGAGCTTCCGCTTTTGTAGATCCTGTGAAACAAGAGAGCAGACGTTGGTAAAACAAAGCAGACCCG
GGGCATACAGTGCAAAGTTACCTCAGCTATGGTTGTCATCGTGGTCACATCGTACACCCGAAAGCGTACCAGCGGCAAGGGTTCGACATCTCGCCGCCGT
TGTTTGCGCTGGTCAAGCACAAACCGCTGGTCCACGAAAACCTCGGCTTCTTCTCGGCAAGACGCGTGCCAAATTGAACCACACACATGTGAGGATTCAT
CACGCCTCCAGCACCAAGTCCGTGCAGTCAACGTACCCACGTGTGGGATGGCGAACCCTCCGTTCACCACCATCGCGTGCAGCTTGATCGTGGAATGCGG
TGGCGGCTCAATGCGTAGCACTCTGTACTTTGTATCCAGACGTTGGTGCAGGAAGCCTACGACATTCTCAAACTGTGGGCGCGTCAGATACAGCGGGAGT
GTGCTGACAATTCACTTGAAGGAGCCGCGGCGTTCGACTCACATCTCGCTCGACATTAGCTCCGCGTCGTCCGCGCTCGCTTTCCAGCCGTGACAGGCGA
TAGGTGGCGAACAGAATGGCCACGAGGATCACTGCACACGCAAAACATCGCCACGAGGTAGGTATACTACTACAGCTTCACCTCATCAACGTATAAGTCG
AAGTTTGTACCTAGCGCGTGCTTCCTGAACGCGTCCAGCATGAAGGCAATGCCACGCGAAGGGGTCGGTTCGGTGGATCCCGTGCTCAGCTCGCACGGTT
TCGGGCCGGAGAGACGATTGCTCCTCTTGCGACTCCTGTCTCACTTGCCAACACGCCGCGCGAGACCGCGCTCCGCGGGAATGCGTAAGGCGAAGAAGCG
AGTCTTGCAGAGACCGGACCGAAGGGCGGATCTTCCCGAGCAGAATCAGTGCGCGGCCTTCGCGTAATGACCTCCACGCGTGGACGGTCAAGCGCTTCGA
AGCAACCAGGGCAAGGCGGGAGGAACGGCCTGGGGCTCTGCACGTGGACGCAGGTCTTGTAAGATACTTTTCGATGTTTTCGCGTCTATGCATGCTCCAT
TGACGATGCCGGCCAAACCGAGAGAGTAGATAAGGTGGTGTACATTGGTGCCGTTAAATGGGGGTAGTAGCTACAGGGAGGCTAAGAATCTGTCCTCTTC
CATCGAGGCCTATGCCTGGGCGTCGGCGCTGTTCTTGACGGGCGCCGGGCCGACGAGCGCGCACGTCTTGAGCGCGTGTCGGTCCATGATCATCTGCGCG
ACGTTCGCGGGTTCTGTCGGGGGCGAGTCGGTCTGCGGGGACTGCTGCGCGTGCTGCACCTGCATGGCCCAGTCGGCCGAGTCGAACCGCTGCAGGCGCA
GACACCGCAGCTGCTCGCGGTGCTCGGCCGAGCCGGGCTCGGGCTCCCGCTCGAGGTCGGTGCCGTCCGACGACGGCGCGCACTTGCCGCACGTGCAGCC
GGCGCACGGGCCCGCGGCGCGGCGCGCCATCTCGTAGTCGGCCGAGTCGAAGCGCTGGCGGTTGTCGCGGTGCCGCTGGATGATGGTGGAGGCCACGGCG
TGCGGGCAGTCGCCCGCGGGCTGGTGCTGGTGCTGGGTCGAGGGCGGAGCGACCTTCTCGGTCGAGCTGGAGTTGGCCATTGTGCTGCCTGCTGCTGCTG
GTGGGCGGAGGAGGCGGGGGAGGAGGAGGAGTGCGGGTGGCTGGGGCAAAGGATAAATGGCGCGGAAGCCCGGCGCCCAGACGCGCGCAACGCTACTGTA
GCCGCGAGAGGTCGCACGGGATGCGTCTGCGTGCACACAGCCAGTGACGCTGTCGGAAGAAGGGGATCAGGCGCGGCAACGTGGAGGCCGATTTTTCTCA
CTGTGCCGGCCTCGAGGAGGACACCTCGGAGCTGATACCTAGCGACGACTCAGCTCGGTGCGGCTCGAGGCTTCCTCGGCGCCTCCTCTTCCGCCGTTCA
CCCCCCAGTCAAGTCACAGCTCGGCGACCTGAACTCTTGCACTGCACTGCGATCTGGGCATGCGACTTGTGCACACTCGCGCCGAGTATGGCGGCGAGGC
ATGGTTCAGAGGCGAAACCGTGAAGTTTGGAGGCGTCTCGCTTCGATCTTCAACGATTGGCGGAGAGGACCCTGAGGACGTGTAGACACCCGAGGCGGTT
TCAGCGCGCTCTTCGGCGAAGGCGGCGGGAACGGGCCGAGCAGCATTGCTGATACCCCAGATGCATGCTGCACTGCAACGAGAATGACGGCCATGCACGT
CAAGCCATGGCGCGCACGCTGTGGTTTGCACAGGCCATTCCAGCGAAGTCGGCGCCAGCGTCAAAACTGTCAAATGGGCAAGTGAACCAAAGGTGTCGTC
AATCAGATCAAACGTTGTCCATGCGGACGCATCGTCATTGTTTCGGGCCGTCTCTTCTGTTGGCACGCAGCGTCGCTGCTGCATTAAGTCGGCCGCCTTA
CCGCGGGCACCCACGGTAGCGCCGACCGCCGCCACAGATGCACGCATGCAGTCTCAGAGCTTGTCGACGTACGAGCCGTCCTCGGTCGACACCTTGACCT
TGTTGCCGATCTCGATGAACAGCGGCACCTTGTAGAACAGAACAAACGTGAACGTGTCAGTCCCGCATGCACTTTACTCCCAATTCCATGAACGAACAGC
GGTCGGTACCTTGACGACGGCGCCGTTCTCCAGCGTAGCATCCTTGACGCTCAGCGCATTCTCCGCCACGCCTTTCGGGGTGGTTTTCTGCGAGCAGGAC
GGAGGTTGAAACGACAATGGTTCAACATTCGGGAAGACGTTCAAACCTCGACCAGAGGAAAGATCCACACTGCAACTTCACTCACCGTCACCTCGAGCGT
CACGTGCTCGGGCATGTTGGCCCACAGCACGTCTCCCTCGATGATCTGGAGCGACAGCGTCATGCCCTCCTGCAGGAACTCCAGCTGCCGGCCCGAGAAC
AGGTCACGCTCGATCTCCATCTACCAACAGTAGTAACAGCAGCAGCAGCAGCAAGAAGCCTGTTAGATCAACGTCGGCACCCTGCACAGTCAACAGAAGC
AAGCAGCACCTGCTCGAACGTCGAGTTGTGCATGATGACGAGGTGGTCCCCATTGTAGTACAGGAACTGGAACGGCTCATCGGGGCCCAGCGGCGCCTTG
TTCACGGTCTCTGCAGCGCGGAAGCGGCGGTTCATCTTGGCACCAGTCTTGATCTCCTTCAGCTCCGCCTGTCAATGAATGATCCGCACCGGTGAGCTCG
TATCTCGCGCGGTTCTGCTCCAAATTTCGTGCAACAAGCTGCGATTTAACGCACCTGGACGTAAGCTCCTCCCTTGCCGGGCTTCACGTGCTGGTTCTTG
CCCACGCGGTAGATTTTGCCGTCGATCTCGAGCGCCATGCCCGTGCGCACCTGGTTGCCTGTAGCGCAGCGATTCCAACGATTTAGACGACGAAAATTAC
ACGGTCGAAGGGCGCGTGGAGTGGCGAACAAAGCAGTACCATTGATGGAGGCGAAGCGCACTCCGTAGCCGCGGGCGGGAGCCGTCGCCCGCGCGATCTG
CGTGATAGCTCGCCGCAACATCATTACGTCCCCAAAGTATCGATTTGGCGGTCTCACGTTTTGAAGCTCATTCATTGGTAGAAATGTATCTGCAACACGT
CAAGGATAGGGTGAAATTCGAAACGATATTATCCAAATCAGCGCGGAAACTATCCGCCGGATTTTTTCTACTTCAATACACTTGACTATTGAAGAAATAT
CCCTCGCCGAGCATGTTCCTCTGGCGGGGTCGGCGCCCCGAGGACGCGATCCAGAAGGCCATCGAGGCGGCCGTGGCGGCGGACAAAGCAGGGAAATACG
AGGAAGCGATCGATCTCTATGCTTCGGGCATCGAGAAGATGATGGCGCAGCTGGGGCGTACGTTGAAGCGCGAAATATCCGCCACCTGAACCTCCCGCTA
AGGCCGTTTATCTGTCATGTGCAGAGCTGCCGGACGACGAGGCCAAGACGAAGCTGCGCCAGAAGATCAACGAGTACATGGTGCGAGCCGAGTATCTCAA
GGACTGGACGGCGGAGCAGGCGCGGAAGCAGCAGGCACAAACTCAGGTTGGAAACGATGATGCAGCGGCAATGAGAACCCAAGCAGGGACGCTCACTGAG
CTGCCTTTTTACCCCCGTGTAGGACGCGTCTACATCGAGTGTGCAGGACGGCAATGCACGCACTGCAAGTGGACGGCAGGTTGGAGGGCTGGTGGTGTGG
AAAATAAGGTGTTTAGTGATAACATTTGACATCTGTGCTGTTGATAGCACCACAAGGCGGGGTACTCGAAGCAGAATGCTGAACATGCGCACACAATTCT
GGACGAGGTATTGGACCACTCGCCTGGAGTGCATTGGGGTGATATTGCGGGGCTGCAGGTGGCGAAGCAGATCTTGCAGGTTTGGACAGCAGCTTGTTTC
TTGTTGTTGGAGATCATTGAATGACGGCATATATGTGGGGGATTGCTGTAGGAGGCTGTCATTTTGCCTACGTTGCGACCGGATTTGTTCACAGGATTGC
GAGCCCCACCACGCGGCGTATTGCTTTTTGGGCCACCGGGAACAGGTACTTACTTACGTGCATGCAAACTTTCGCCATTGAGTTTGAGAATCTGTCGGTG
GGTGTTGACTGATAGTGCTTTGTGTGGTGTTATTGCATCAGGGAAAACGTTGCTGGCGAAAGCTGTCGCTACGGAGGCGAAAGCAACATTCTTCAAGTAA
GTTAATGGTGACATGCACAGCCCTAGTGTTGGGCCTTACTGAAGGATGTTTGGTGCAGCATTTCTGCGTCGTCGTTGACGTCGAAGTGGGTGGGTGAAGG
CGAGAAGCTGGTTCGCGCACTGTTTGAGATGGCCCGGGAGCTCCAGCCGTCTGTGGTTTTCATGGATGAGATCGACGCCTTATTGTCGACAAGATCAGCG
TCCGAAAACGAAGCAAGCCGAAGAATCAAGAACCAGGTTAGTAGCGTTACTGAAAGTAGATCGGGTTGTCCATCGCAGCAACCTGACTGCTAATACTTGC
TGGTGCAGTTTTTCACTGAGCTCGATGGAGCAGCTTCATCGCAGGAGGATCGGATCCTCGTCATGGGAGCTACGAACCTCCCTCAGGAGCTCGACGAGGC
CATCGTGCGTCGTCTGGAGAAGCGAATTTATGGTACGTGGTTCCTCTAACCGCCACCTTGAAGACAAGCGCATCTAACCTATTTCCTGACGCACGCTGTC
ACTGTCGTTGGCAGTGCCCCTTCCAGATGCTCCTTCTCGCGAAGGACTCATCCGGCACTTGCTCGGCAGCCAGAAGTTCTCGTTATCGTCCAAAGATATT
AAGCACATCGTCAAGGCAACAGAAGGCTACTCTGGCAGCGATCTCAAGGCGGTGTGCAAGGATGCCGCTTTGGGTCCTATTCGCGAACTCGGAGCTAAAG
TGGCGAACGTGAAAGCTGAAGATGTGCGAGGAATCAATGCATCCGACTTTCAGGTGGCGCTTATGCGGGTTCGGCCGAGCGTGTCCACGACAACAATAGA
GGCCTTGGTCTCGTGGAATGAACAATATGGGGTGTCTGCAGTATGACGAGCGCAGGCTTCGTTGCTATATTTCCGGGGTTGCTTAGGCCTTCCGCTCGTA
AATCATCAAGTAGGACTCGGACACACCGATAAGCTGAGGCATCGTTTCCTGGACGTGGAGATCTTGGATCTCGTACCATTGCTCAGTTGCCTGCGGCAGA
TGAACAACATACAATACATCAGCTTAACCATGTGTCAAGTATGTGCATGTTCATCAGCCACGTACTCTATTTTGAACATGGACGCGATAGCTGCCTTCCG
TCAGCGGGTTCGTTTGGAGCGCCGCCTCCTGGCCTGTTGTCACCGGGCTGTCATGGCAGATATTGGCAATCAAGTTGTACCTGCGACACAAAAACAGATT
GCACAGCCACGTTAAGCCCTCACTCACCCCCACGACGCTAGCTAGCGATACGTACTTGGTGGATGGCAGGGTGACACGCAAAATCTTCTCGACAAGGTCG
GCCTTTTCCACGCAATCCTATACCAAGCAATAATTCAGCTATCTTCTGCACGTACGCCCAACAGCAAACAACAAGCGCACCTCCGTGGACTGCTTGTGGT
TGCGAAGGATATCTCGGAGCTCAGAGATTGACCTGTGAACAGCATCGATGTTCCGAATTTAATCAGTGAATACCAAGATAAGATATGGTTTCGCCACACG
TACTTGTTGCGGAGCTCTTCCTCCGACGGAAGGCTCTGATCCAGCTTCAAGTAATCACGCAGCTCCAGATTCTTCACCGGAAAGGTTACAATCGTTGGAT
TCTTTTCAATGAAGAAGTTGTTCCGCGTGAAGCGCTTCACGTGGAAGATCAGATACGCTGGCAGCGAGTCGATGCGGTACGTCTTCTTCAGACGATGAGA
GCCTTGAAGCACGTGCGTTACGTGCGAGCCGTTGTACTTTTCAAGCACTGTAAAAAGCGGAATCTATCCCCATTCACCCAATGACCTTGTTAGTTCGTCA
CTCCTTCATTTATGCACAAGGGCGTTGCTTTAATCTCACCTGAGGAATGATATTTCCACCTTGAGAGTCCTTGAACAGCGGCGTCGACGGCAAGTCAAGC
GCCATCATCCTACAAACGTAGCAACAATGTTCAGCGGAAGCCAGATACGGACAACAGCTTAAGCGCGTAGCAACTTACAAAAACGGCGATACCGTGGTGG
AAACAGCGGATTCGCGCTCCGCTGGGTCTGCCGACGCGGCTTTCGTTTCATCATCCGTCGTGACCTCCACAAAACCTTGGAAGCACTTGTGGATGATACT
GCTACCAGGTTTATGCGATCCACCCAGGCCCTGACAATGCATTGAATCAGACAACCCCGTCAAAACTTTGTTTCTTTAGCCGCCAACTAAGTCAGCCTGC
ACCTCACCCTGTGCAGCTCGTTCAACAGCCACGCCAACAGCTCCACACTCTCGTTCTGTGTCCCCACGTGGAACCTCTTCTTGCTGCTCACCGAGATCTC
CTGCACCAGCTCGTGCGGACTGATCTGCACCCACCCGAGCAAAGCAACGCACATCAGCACACGCAAACAGCACAACAAATAACCTTTCTCTCAATTCCAC
GCGACGCACCGTGTTCTTGAAGTTGTGCGGGCTCCACATCTTGCGCAGCAGCTCTCCGAAGCGCAACACGAGCTTGGACTTGATCTTCTTCGTCGTCGCC
GCGTTGGCCAGGAAGAAGTCGCGCAGCGGCGGCACGTGGGCCAGCGCCTGCACCACCACGTTGATGTAGTCCGTGTGCTTGAGGTTGTTGAGACCGATGA
AGCCCGGCAGGTACGACACGCCGAAGGCGTCCTGCGCCAGGATGCGGTTCTGGTCCAGCCGCGCGATCTGCTCGGGCTCGAAGGCCGGGCGCAGCGCGTC
CTGCACGGGCTTGAGCGTGTTGTCCACGACCTCGTAGTTGTCCGGCAGGCAGTAGATGCGGTCCGTCTGCAGGTTGATGAACACGTGGTGGCTGCTCTGC
ACCGAGTGCGTGAAGGCGTGCGTGTTGCGGCCGCGGCCCTTGAAGTACTTGCCGCACACGAGGCACGCGTAGACGTTCTGGTCCGAGAGGCTGATGGAGC
ACACCTTCTCGAAGTCGAAGTCCAGCAGCTGGTGGTTGATCGTGTCCAGGTACGGACACTTGCGGCGCTTGGCGCCGGCGTCCGCGGCGGCGTCCGCGTC
GGCCTTGCGCTTCTTGGTGGCGGACATCG