Description :
From Genome Similarity Track
Location :
scaffold_14:53773- 55151
Transcript NameFunction/comments
Plaha_PHALS_08160RxLR-like protein

Sequence
1378 bases(100 bases per row)
GCCGATTATACGGTCAAGGTAGACGCTGCTACGACCATTCAGTCTTCGTGGGACGGCTGGGGTACGTCACTTTGTTGGTGGGCCAATCACTATGGAGAGC
GCGTCGACATTGCTGATGCTCTATTTACTTTAAACAAGAGCGTGACAATTCAAGGCTCTTCTTCTGGACTGCCTGGTCTTGGCTTTAACATTGCTCGGTA
CAACATTGGAGGTTCAAGCAAAAACGTCGTTGATGACGATGGTAAAGAAGTCGCGATGAAACAGTCGAAGAATATGCAACCGTATAGGTTTATGGAGAGC
ttttggattgattggatgaGTGCAGATACTGCGTCGGCGAGCTGGAATTGGGATGCCGATCCTAGACAGCGTGCGATGTTGATGCTTGCCATCGAAAGGG
GAGCTGACCAGCTCGAAGCGTTTTCGAATTCACCACCGTGGTGGATGAACCATAATCATGCAACTGCCGGTGGAGATAACGGAAAGAAGGACAATCTGAC
ACCTCATAACTAcgaagagtttgctctgtacCTGGCCACAGTTGTAAATATGTTCAAGACGCGCTGGGGTGTAAACTTTGATTATGTTGAGCCATTCAAT
GAACCATCCGAATCGTGGTGGGAATTTCCTAGTAAGCAGGAAGGATGTCACTTTTCGTGGGCTACTCAAAAAAAGATATTAATTCTGCTTCGcaagcagc
tggatgctctGAATCTGCAAGATGTCGCGATCGCTACGCCTGATGAGAATTCGCCTGATGCAACCTTACACACACTTGAAGACATGGAGAAGACAGCTGG
TATCGTCGAAACGTTTACAAAAATTAACACACACGGGTACCTCGGTCTGGATGCGTATCGTGGTGATAAGCGTAAGCCACTTAGAGACCTCACAAACAAG
TTCAAAAAGACGTTATGGGACTCTGAACTGGCAGAGAACGATGGCTCTGGTCTCACCATGGCTGAGTCAATCGCTCTTGATATTAACGAGATGGGCGCAA
AAGGCATTGTGTACTGGCAGGCGCTCGATAGCGGTGGCTGGGGCCTCATTGCTTCTAATCCGGGTGATGACTGGATGGGTGAAGCCAACCCGAAATACTA
CGTGATGGCGCAGTACACCCGTCACATCCGTCCTGGTATGCAGATCCTTGCCTCAGACGATGTGAAAACCGTCGTGGCTTTTGATGCTGACAAGAAATGT
TTAGTACTCGTGACAGTGAATGTGGGCGACGCCCAGTCGATCACGTTTGACCTCGCAAGCTTTGGAGCAGTGACTGGCCCTGTCATGGAGTGGACCACTG
AGACCAGCGGTACGGGTGCGCTTTACGTTGAAAGCACTTGCCCTATCGTGGGTAAATCGTTTACCGCCAACTTACCGG