Description :
From Genome Similarity Track
Location :
Scaffold_33:537668- 539237
Transcript NameFunction/comments
Physo_134741hypothetical protein

Sequence
1569 bases(100 bases per row)
GTCTGTAGTTGGCGGTGCAGCTCCCGGATCGTAGCGACGCATTCTCTCGCCACATCGACGCGCCTCGGAGAGCAATCGCTACTGTTTGGCGTCGCATCGT
CCATCGTGTCACTCCTTGAGAACGTGCGGGACCCGAGGCGAAGTCGAAGTTTCATGCTTAGTGCAGCGAAGGTGAGAGTGTATGTAAACTGCTTCGGTTG
GTGGAAATTGAAGAGTGATGAGCTGATTCAAGTGCTTGCGTTAAAAATGAACTCGCACACAACTTCTATTTTGTGGCCCTCAAAATAGCCGCGAATCCGA
TCTGCATGATCCCAAACTGTCGTGCGTTTTCCTTATTAGCAATCGAAAACTAGTTTCGATCACGTTTCCCTCCCTAATACGCAAACGCATGGGCTTCAGT
ACTTATCGCTGCGGGCGCCTTCCTTCGCTCAGTGGCATCGTACGGATCGGTTAGATAACGACATTGTACGGAACAATGAGCACGTCAACGCACTCTCGGC
TCCCTCGGTCTCCAAACACGGCCCGAATCGTGCGCGATGGGTCAATCTCGTCACTTGCAGCTAGAGCGCGAAGGAAATTCGCGACCTGAAGAGTATGTCG
CCCCGTCACTTCGCCACGCTTTAACTGTGAATGCCTAGTGCTCGCCTTGACAAGCTTGACCATTCCAGCCATCCTATTGTGAATTTCATCCTTGAGCTCG
GCGACAGCTGCACTCTCGTTGATAACGACCCCGAATACGTCGTGACCACAAGCGCAGGAAACTTTCCTGACCGGAACCAGCGCCACAAGTTGGACTGACG
TGGCTTGGATTCCTCCAGTAGCAGGCGGGAGCGCGATCCCGGTGTTCTCCTCGTGATGCAGCTCGTCCCAGTCCGACAAAATGTACTCACTCGCCCACTT
GAACTCTCCTGCCTCAAGGAAATCTGATAGAAGACCGAGCTCGAAAGACGCGCTGGAGATGTATGTGCCCCGTGGACCTGTTCTGAACATTCTGACCTTT
GACGGGTGCACGTCTTGAAATTCTAGCGGGCTGCGAGCCTTGAGTAGGACGGACACTTCTCTCACGGTCGACGTAGGTGGCGCGTCAACGGCCACCAGAC
TCGATCCGGCAGCGCCAACTACCGCACAGGAAATGCTCGGCATCGTGTCGTGGACTCTTCGCAGCGAAGTGATACTTAGTTACCTCGTCCCAAGTCGATG
TCATAAACTGTCAGATTGAACTACAAATGTGAACAAAAGTGCAACCATTCGTTGGTTTGGGATACACAAACACTTTAATGTTAGCCGAACCAATTCATGG
CTCTCATCTATAAGCATAACACGTAAGTTTCGTTCTTGTAGTGTCAGTTATACTTCTTGTTACCTCCTTGACGTAAAAAATAATTTTTTTTATCTTACTC
GTCCTGTAACAACATTTCGCTAATCAAATATTCCGATACAAATTTTCAGTTTACGATCACTTTCGAGAGGGGTTTGAAGTCTTCCCCATCAATTCCGACA
TCATCAGTCGAATGACCGACGCGTCCGCCGCCTCCTTCCAGCTCATGGACGACCAGGACCACGTCTCCA