Description :
From Genome Similarity Track
Location :
Scaffold_292:53762- 59549
Transcript NameFunction/comments
Aphin_H310_08583Intraflagellar Transport Protein 140
Aphin_H310_08584conserved unknown protein

Sequence
5787 bases(100 bases per row)
GCCGTGCGTCGAGAGGTTCCATGGCGCTCTACTACGACTACAACGTGGACATACCGACAAACGCGAGGCAGCTTTACTCGGCATGGAGCGAGGTGGAGTC
GGTCCTTGCTGTCGCGTTCGACAACCACGAAGTGCACTTCTTCAATGACGAAGTACGAGTGCCCGACCGATTGAACTTGATCGAGCGTACACGTAGGGAG
AGCGCCTTCAGACTCCTGTTCACACACGAAAAGCAGACGTGACGTCGATTGCGTGGCAGCCCCGTGGAGCAGTCCTCGCCGTGACATGGAGCGACGGTTC
GAGACACATTCACGTACCCAACACGTCGATCTTCTATCCCGACTTGTAGGGATGCTGTCCCTGTGGATCCAGAAAGAAAATGTCGCCAGAGAAGTCAACT
CCCCTCACACGAGCCGCATCAACTTGCTCAAGTGGGCGCCGAGTGGCAACAGATTGATCACGGGCGACGAGAACGGGGTGCTGGCCGTTTGGAAGATCGA
CGCGAGAGGCCAAGTCGGTCTGTGCACGCAGTACACGCGGCAAGGGAGCTTGACGCAATGCGTGTTTTGCGTTGTACCGCAGCGTCGAGACAAAGAAGTC
AAGAGGTCTGTGCTCCTCTCTCTCGTTCTGCCGTGCGTTAACGCGTCGATTCCAGCGACAGTCAGTTTGCCACGACGGCATGCCCGTCGTTCTTCTTTGG
AGGGGACCTCGGCACCGTGCATTATGCTGACGACTTGGGGCACATTTCTGATGTCCAAACACTCAATCACGCCATCGACTGCATGATGTTTTACGAAGAG
AAGCATCGGTACGCGAGTGCTGCATCCGCTGTCTCGGTCACGACGACCTGGATCTGATTGTCAGGTTGGTTGTCATCACGCGCGCGTCCCAGCTCGTGCA
GCTACAAATCGCTTCCGACGGAACGGTCAAGCCCATCATGAAGGTGAAACTGAGTGTGTCTGGGGACGGTGGTTTGAAGGAAGCCATTTGGGCAGGACCA
GGTCGGTCGGCGCCGGTTTGGTGCGTGCTCAACGTGCCGTAGGTCTGTTGGCGACAGCATCTGGCGAGCAGCTCCTTCGATTTTGGGACTTGCAAAAGGA
AGAAAACTATGTGCTGAGCCTGGCAAACGGCGGCGCGGCTCCCAGCGACCGGGTGTCGGCTGTCGATTTCAACCCGCGAAAACGCATCTTGGCCGTGGGT
ACGAACGAAGGCAAGGTCGTGTTTTGGCGCGCCACGAGCTCCGCCCAGACCAAGTCGAGCCAGTGGTCGCTCGTCGCGGTCGCCGATATGCATCAGAGCG
TATCCAAGATCGGGTGGAACCCGCTGCACTCGTACTTGTACGCGCATGCCCACGGCGCCGGCGTCACGGTATTCCACGAAGCCATCATGAACCGATCGCT
CCACGACGACACGGCCGTGATTCAAACGCGGCCCATGTCGCTGTCGGTGGAAAAGCTCCAGGATGGCACGGTGGTGCAGACCACGATCGAGGCATCGATT
CGCATCAAGGGCGTCGCCCATGACGGCAACTTGATCCTGGTCTGGAACGGATCCAAGGCCGAGGTGTACGAGCTTCAGAACGACGTCGACGCCAAGCGCC
TGAGCAACTTCAAATGCACGTCCAACGCGATGCAACTCCGCGGCGACGTCATCTACCGCACCAACGGCAACCACATTGAAGTGACCAACACGAGCGGCGT
GGTCAAGAACACGATCTCGTTCACCGAAGCCGAGGGCCAGCCGAGCCTCATGCACGTCAACAACAAGTACTTGACAGTTGGCACGGACGCTGGCCTCCTC
CGCGTGTTTGATCTCTCGAGGCGTGAGCCAAAAGCGTTTGGGAGTCTCGGCGACATTTCGGTGCGCGCCGTCCGGCTTTGACTGACGTTGACGACTCGAC
ATATCGTAGAAAGCATTCGCCGGCATGGACACCAAGTCGACGCTGCGGTCGCTGAGCGTCAATTGCGACGGAACGCGCGTGAGTTTTCTCTTGGACACGG
TCGAAGGAGCGCTCCGAGTGCGCACGCCCCACACCAAGCTGTACCTGTTCAACACGGACCTGAACGCGTTCCAGTCGTTCGAATTCGGCCCGGCGCGCCA
TCCGACGTCGCACTTTTGGGACCCCCATGAAGCCCGACTCATGGCGTGCGAGACATTCCAGGTACCCGCCACTGTCGAGGCACGTTGAACGTGCTCAAAC
GGGTCGGGGCAGGACAAGTTGGACGAAGCCAAAGTCGTCGTCAGCGCCGGCGAGGCCGACGACAAGAACGCGCCGCCACAAGTCGACGCCACACGGCATG
CCGAGCGTGAAATCACGATTCTGTTTGCGTCCAACGAGCGCGGACTCCTCATGCAGGACAACTTTGACCTGGATGTCAAGTACTCGGCGCTGTTGGGCAT
CCACGTCCCGCGCATGTACCTGGCATCGTCGCAAGAATCGATCAAGCGAGAGGCCAAGGACAGCGCGGACAACGCGCCGGTCGCGCTTCTTCGGACGAAA
ATCATGCAAGACTTTGTCGGCCTCGACAAGGTCGACGGTCCGACGAGGCAAGCGCTGATTGATTTCTCGTACTACATCACGATCGGCAACATGGACGAAG
CGTATCGGTCCGTCAAGTTGATCCAGAATGCGTCGGTGTGGGAGAATATGGCCAACACATGCGTCAAGACCAAGCGGCTCGACGTGGCCGAGGTATGCCT
TGGGAACATGGGCCATGCGCGCGGCGCGGCGGCTGTCCACGTGGCCAAACTCGAAAACCGTGAAATCGAAGCGCCGATCGCCATGGTCGCGATTCAACTT
GGTCTTCTCGACGACGCGGCTCGGCTGTACAAGGAGTGCAGCCGATTCGACTTGCTCAACAAGCTGTACCAGGCCGCAGGGTACTGGACCAAAGCGATCG
AAGTCGCCACCAAGCGCGACCGGATCCACCTCAAGACGACGCATTTTGCGTATGCAAAACACCTTGAAGACGAAGGGAACCTGAAAGAAGCGATTCGCCA
GTACGAATTGGCCGGAACCGCCGCCAAGGACGTCCCGCGCATGCTCTTTAGTCGGGGAAAACTCGACATGCTCAGCAACTACGCCACCAAGTCGGAGGAC
CCGCGCCTCCTCCTCTGGTGGGCGCAGTACCAAGAGAGCAACCAAGAGTTCGACGCTGCCATCGAGTCGTACCGCCGTGCCAAGGATTACCTGTCCCTCG
TCCGCGTGTTGTGCCACAAAAAAGACTTTGACCAGGCTGCGCAGGTCGTCGTCGCAAAAAACAACAAGGCGGCCGCGTACCATCTCGCGCGGCAATACGA
AGCCAACGACAACATCGCGGGCGCGATTCAGTTTTACGCGGCGAGCGGGTCGTACAACCACGCGATTCGGCTCTCTCGCGAATTCAACTTGGACGGCGAC
CTGATGAACTATGCTCTCCTGAGCAAGCCTGGCCCCATGCTCGAGTGCGCCCAGTACTTTGAAGGCAAGCGCGAATTTGAAAAGGCGGTCGTGCTATACC
ACAAAGGCGGCCACGTGGCCAAGGCGCTCGAGCTTTGCTTTCACGCCAACTTGTTTGACGAGCTCCAAACGATTGCAGACGAGCTCGGGGCGGGTACCAA
CACGTCGCCGATCGTACTCGCGAAATGCGCCGACTTCTTTGCCAAGAATGGCCAGCATGCCAAGGCCGTGCCGCTCTTAATCCGCGCCAACCGCCTCGCG
GACGCGCTGGACATGTGCGTCCAGAACAAGGTGAAAATCACCGAAGACATGGCGGACCAGTTGACGCCGCCGAAACCAGCCGACGACGCCGACAAGGCCG
CAGTCAAACGGCGCGTGGATGTCCTGATGAAGCTGGCCAAGTGCTGCAAGCACCAAGGATCGTTCCACTTGGCCACAAAGAAATACACGCAAGCGGGGGC
CAAGCTCAAAGCAATGAAGTGCCTCCTCAAGTCGGGCGACACGGAAAAAGTCATGTTCTTCGCCAACGTGTCGCGCAATAACGAGATCTTCGTCCTGGCA
GCCAACTACCTCCAAAACCTGGACTGGCGCCACGACCCCGAGATCTCCAAGAACGTGGTCGGGTTCCATACCAAGGCAAAGGCATTCGATCAGTTGGCTC
GGTTCTACGATTCGTGCGCGCAAGTCGAGATCGACGACTACAAAGACTACGCCAAGGCGAAGCAGTTGCTGGAAGACGCGATGAAGGTCGCAAGCAAGTC
GACAGGGCCTGGCAAGGACAAAACGGTCGCTGGGTTTGAGCACCGCATTGCCGCCATCGACACGTTTCTCCATGCGAAATCGATGGCCACGTCCGACCCG
GCCGAGATGGTCCAGATCCTGCACCACCTGCTCGAGGACGCCGACATTGACTCGGCCATTCGAAGTGGAGACGCGTTTGCGCTGCTGGTCACGCACGCGT
GCGACCGCAACGACTACCAACACGCAGGCGAGCTCGTTCACGCCATGCGCCAGCGCAACATCTCGGTCAAGGCGTTCATCCACCAAAAAATGCTCGACGA
CATTCAAGCCAAAGCCGACACGATGACGCCCGAACGAACGAGCGACGCGCGGCCCAAAACGACCTCCGACGCCAAGGACGGCGGCGACGACGACGAGTTG
CAAGAAGACATTGAAGAAGAAGACGACGGAATTCGTTCCCGAAAGTAGACAACAGCATCGTCTTGTCGATAAGCCTCGCGGCATCACCATGCATTGCATC
CTTCTCCTGTCGTTCCCGTCATGCAGAGAAGGACACGACGGGTCGATGGCGTTTGAAAACGGCGGCGCTCGACGCGAAACTGCAATCGAAACGATTGCAG
TGTCGTGCGCCGTTTGATACGATGGCCACCACCAGCCCAGACGACATGATCGAGTACTTGGACAAGTGCAGTCTGTCGCAGTACGCGACCCCGTACTTGA
CATGCTGCTTGTGCAACAGCATCAACTTCATCGACGTCCCGAGCATTCGCGGCATCCGTGCCAAACGGTCGTCGACCGAGTACGAGTCCCTCCCTCCGTG
CTGTGGTTGCGGCAGCACGCGGCATCTGCGCACGGGTGCCACGAGTTTCCACACCGAGCTCGAACTCGAGTCACAAGCGTTGGAGGATTTTGAAACAAAG
CGCTTGCCGGCCGCGATCGAAATCCAGGTAGTACGACCATTGGCATGCACATTTCTCGTCGGCATGCTCATCGTGTGTCGATCGCCATAGCGCGTCGTGC
GAGGGCGCCTGGGTCGCGTCGACGCGAAGCGCCGCCGACTTGAAAAGCAGCGGTGGGCGCGCCGCATCTTCCGGGCAGCTGCATGCATTCAGAAACGCGT
GCGCGGCATACAAGCTCGAACGCGGAGTGACATCGAACGGTGCATCTTTGTTATCGTGGTACCCCGCCGCCCGAGCTGCTGGAGTCACACCGTCTCCCCG
TAGAATGCGCACCCTCTCGTGTATGCCTTTGCCACGGCCGCAACGACCGGCAACTCTGCCCAGCCACGAGGAGAACGGGACATCTTTTGGTACGACAGCG
CCGACGAGTTGAGTGTTTTCTGCTGGGACTACCGAGAGTTTGTCCGACGAACGGGGGGGCGGCCTCCTCTGTGGCGCGTCGAGGCCAACGTCCGCGAAGT
CGCAAAGCGCATCCTACAGCGAGAACATGTCCTCGTGACACGTCTACAAGCGCGGTGGCGAGGCATCACAGCGCGCAGCTCGATCTACGAGCTCAAAAAA
CAACGTGGGTGGGTCCGCAGTCTGCAGCACGCCCCTGTCATCAAAATCCAGCGGCAGCTTCGTACGCACCAGTGCCGTCGACGATGC